ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:28  "*(2 HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%8o'"6_[MrCL VsE+e,úo܋?)4l$vBN뙣'X:k~]R~?iNIݓ+q `8t?'CQV֮!Ul9A;rz@N5,'턼6c}FU ߫]6t˅N?,_»+ߪ漢AlnVn.ܫ(kf|x:tsLt^Or/HgZ7N1Eeic={ޫθ[h"[mx`>G#s GY^y+z=Wn՜6ZPki4蔾Taq:J䋈OI I?TI%8e_,ҴrYp ueU|QEƲ֑p>?M{_Mmc@$VesɆ:g._:f]mƺ}7ޡջkGpu_kk GŻ>n5mgϊc5ZZ{#V 'D<Oo\ջN:?N'6mMXt{>!Pf]+?dǢ 1OUbu2jBlR }%qSni0 ns:nw/Ìᵣ#as|7?*%Ab)V}Yޞ2a0Ǻvר!s?W0>3ibdckvx T'u6 ;+;}!x@I$ֿTI%<#!TeOmέ5,'?Rw^6c{*Y[_hpciI+?;#Ӝvc? 5SgLڴA*P}4rK'#H5-FōeʞkjFG]cf^=|:k3Z$LlRo.Cƪk+Q?l.8OZVHBm\ OotlpOע#% `5 VƒuM^2+1L>VIк4%`7m-ϦmtZ Hs\75 5/=c-2T~=ðs{;\In&=BA^ǸW!?*ܴ:L;;$zTI%<ֳFTOjoXO)uf~X668Tw%5nΒu$IVFOZu63Ssh \?SMeRR7GoT]cm,7\\*Qn9AtA.ƨGHh?*]o{ k\I䀬uj6a;Y㷒wz3D?R?#(zS}<9ƚL$΅,qc:vQs`؞5xkRኬMMSu|`)KGNʑX-'sL@0ipVTmw: 'iƶd[^˶4lK7;?FlcZ`C5v ?4fV-ϱ]UVAötuz!`pi<48njXx7=1y[wo[_WL[?#ugI$?TI%4ƿÔ]w^0ibWuG꘍7mjc#isoIugI$?TI%<ְOSm[Zg^G8'׍|Ր|F鳏GHـy$[e݂[?[~ȥcqpqQ.UM]DdO?K+&TFG1;+(/xKx^WDdaC\%sUlh&Zaà s43_?_kx{\?+O J gOr72Hib6쌁utOƴpZ]O9}Ԃ?;=RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$.Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-1 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q  Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%8o'"6_[MrCL VsE+e,úo܋?)4l$vBN뙣'X:k~]R~?iNIݓ+q `8t?'CQV֮!Ul9A;rz@N5,'턼6c}FU ߫]6t˅N?,_»+ߪ漢AlnVn.ܫ(kf|x:tsLt^Or/HgZ7N1Eeic={ޫθ[h"[mx`>G#s GY^y+z=Wn՜6ZPki4蔾Taq:J䋈OI I?TI%8e_,ҴrYp ueU|QEƲ֑p>?M{_Mmc@$VesɆ:g._:f]mƺ}7ޡջkGpu_kk GŻ>n5mgϊc5ZZ{#V 'D<Oo\ջN:?N'6mMXt{>!Pf]+?dǢ 1OUbu2jBlR }%qSni0 ns:nw/Ìᵣ#as|7?*%Ab)V}Yޞ2a0Ǻvר!s?W0>3ibdckvx T'u6 ;+;}!x@I$ֿTI%<#!TeOmέ5,'?Rw^6c{*Y[_hpciI+?;#Ӝvc? 5SgLڴA*P}4rK'#H5-FōeʞkjFG]cf^=|:k3Z$LlRo.Cƪk+Q?l.8OZVHBm\ OotlpOע#% `5 VƒuM^2+1L>VIк4%`7m-ϦmtZ Hs\75 5/=c-2T~=ðs{;\In&=BA^ǸW!?*ܴ:L;;$zTI%<ֳFTOjoXO)uf~X668Tw%5nΒu$IVFOZu63Ssh \?SMeRR7GoT]cm,7\\*Qn9AtA.ƨGHh?*]o{ k\I䀬uj6a;Y㷒wz3D?R?#(zS}<9ƚL$΅,qc:vQs`؞5xkRኬMMSu|`)KGNʑX-'sL@0ipVTmw: 'iƶd[^˶4lK7;?FlcZ`C5v ?4fV-ϱ]UVAötuz!`pi<48njXx7=1y[wo[_WL[?#ugI$?TI%4ƿÔ]w^0ibWuG꘍7mjc#isoIugI$?TI%<ְOSm[Zg^G8'׍|Ր|F鳏GHـy$[e݂[?[~ȥcqpqQ.UM]DdO?K+&TFG1;+(/xKx^WDdaC\%sUlh&Zaà s43_?_kx{\?+O J gOr72Hib6쌁utOƴpZ]O9}Ԃ?;=RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$1D1Zw֏o<1Zw֛e$Ao'f[_Dž]o}h ;Gf_Dž]3`~? Ӿ|2Dž4ײַ {>J~?  xSN}de ~? Ӿ|20DžiY>GPDžiY>~? Y>𡯬  xROc xPײַ 8ROW*xPOoL0p|3$k'7&𫾲|20Dž] <*ײַ L1W}df>I<)p>_?ߏc†|3~?ᇁ]  wO_*BcO1V|1?ߏc‡}`e%AwOXL1V|3`~? ZPDžW}de~? / xP o2~ ] ?ߏaWz+ < Nφ_.8VAs +Nφa?ߏaZk,.DžiX>鴯c´߮|2 ~?ӽsy6<+NφSy6G1Zw|3&z76;>Dži޹< Nφol1Zw|2p& ?ߏc7 ?ߏc;>_?ߏbq |2<(w|2Ǔ`?1Kc| xUޱ<y®No|1Cc xUޱ߆z+ xB>?ߍc®a xPXf>M®φ7 <)o9?ߏ`C^w|3'o [N7# xV(?ߍ`Wz/# xUީ| xUީ Cws(owyF~\8G xUޮX?1WzGPc~~o?1WzPDž]fR߆<*S7J~C% xUަo?1Wz~7ᇅiަo?1Zw|v7 ӽLHߍc®ra~7ᇁio?߆< g/) +Ns!v1Wz(RmcS,yR~;| *P>T~~)\´[~~:_ <+M[~5\Qo B |1\ȿ i]\_߆4c؇+>_~~Ҹ;~.f:cDžiGB~~;7oco xV?of /?6v0RӲǗcK-8>^ oW i#v0һ<߆ C"v0%ӠZroeKN?oZvW SN?oӱcbQ1iѐrlV4H V4H;7H;78ߠcӲiنV*1Ɩ$qZvX#cbб1iٿBӲB4ߡS4챢E;+4qZvaFhvof qf V4qf4qZv_X;7HD4ߡccNَ4Б8iѣ4qcBƑN pRӳ ?8ӳ~O8ӳ ?8i4FNqe~4#͍-;-eZ|G|iiَӑƖ:J8ӱJƖ$8x]Zk^e 5;"TƖ4qe~IZvcn<4bG S१c[Ni-;JPČix]tCi<.ğMƗGL' -;(X/?L ^c4p)ٗOFjTe~xVt n8;lBIvZX+w8)x]~O87褮qSJA#%´GHz ӱN@+SiBvƖ}5GBM1fLLi<.Ɲ=Tщ^cMF4k"NXBN4e4ccVkx]&h"m(Ɩ:rqeigJzc´щԱDžiؔJd} cKNwM;4եI8ӱLBF4v0)RwƓ쳧 4,qS7Ph 9cMRqZvYӓVz'KN8V8)iٓOVn58ӱFґhKN:bZva'v8ӳ~4ihƖh$ f{ո5KNM9l==.4! x ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'?G$(NX[ͅ-fƕW+:x\ 㗅]Li%,o50+bż͋'f4W5p+5] 1fnآ\| ejWSצI-qVl p1W+ [viC|Rq0!7.9glP6\UƑ]\]\eb,b9xpUَu3W [ʮr W6*]ӊS\N?*ͅ-f*c1[LPs* r88a)L)p=kv(F)usbcYELo(u1إw.ˮثRULU4ckfo UV)\2 UqVq S*UrcOlcqCu UnEq*L *j0c[lUcTn1Cc|`V8:bcw=0$W(`W إv_MCT&T4napF4(urWf+S qWfm1‡ h뎦;04]N(vVE[a͊6u͂fZ9- `W:qWW1RpƄ.__\1V@1WeaWf ˜UD R9\uqS ⮮c(o6)vjf8B]vQp"ULU(bbrfmbr%]:Rb-0٘aWe!­f"U}w]L*cH®̸]va]WfE͊*]qWe6R졾,WcI*@c'eW(덫7[I]M\Ur`VR2JmVP[ǮvX銻+*q]qcB$6M.7p+šb-F)LU6(va_|KdUm Du6`*M֦PiKbF*m*p%وWci]v4]LUT],b\Pva]+.Uنvnq‡fvYڻA)T/\UGvlUeqWeq8R]F*n‡eWe=1Wf덫*bv4bʮUm.k *M+LUl~#)vW \P~$v"늻7e2np$;H5[l*U ث;vW7AĶbl*JX늻ɸ=qWc'N%ٚ?abb> w'*n s] jTC*8_|PyJU؜jTSI]1**SOء8#)vS7w*yr _qWe*A;WvPRzPĥI8"%'6R5*C;m*z+۲Ff8ӱaCx u]~-](vV8ؚ.U٢pQ~m)Jvr GZ]HQQZv:&]t WǍ] L p_7h ]E,۶*w@q>r|D,KY[ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'??ē%Cl(1.Rm[V!1[с8$8c [ǝG(VF*ᕊ[r運Yxَ*졊c[Cq U`WcXba]jd;MqCG50!]«NaBܳCWvQ]ث*UٱKUٱCc5qVuZ9pYxCnGVI-]+v^*UX3 b'V0Web8c0]bJJ\A뛈]\eU튺[bqKQ.beUi`HŋSثC+2CkqUU8ثYWvj .WfU٫]^*i Zk¸kqUDxWclUٔPo$4sadYe4b尦*VP58X\q.ʯoN)le01] SDemmٰ۳aVV*]Cr]3m]#nR1U^Rs*j (.Ɔ$bck.N;+*f V\UM]N*4Uu.Q]L]L]Lk1Webv^vU1We]"6yx q1WbU]\ ƅv7®𫱁i-4rDXC+|Rp.]Z` jq*켂5qWeUU]v`pi5]-1 m7Xָcف`K&UmqWe*e"e6t7@#"fvn8t]@8Uځc 'iven9[Ublw)lf.E.\sEaCXcv6`C").*qK+qeq *Ԧ*]LUَъ/vjWc]]LRb]-2*qWck*W|P젼WfaLU]]1Wer#lUa*Uى®vY# }+aWe*zb]v )vmWe4N!ber=qWfgV늻`)\UȠ.lF*oUAdmLR촢!]S_;8ظP‡v0ASA;]aWb,8;`K:mEqWbLLP2{ PcATlQ]iJЮ(v&V*F@E*ULUپJNH®Wbd)$bJZ]EO\X+fv]' }8mj|C8pHO6tbx.)v'1WbJ Wb f%WbF4좕H.ˈq98ܸ PBKnR]L ]a:RX0Pv[6ԥ+]?vw.J]W`sS-]4B)Ej(+BI;w㊻.' qc]^ثބaM;Vu'ۮ(vSWR,E 1WcyxUٙB #RrBlURCr9_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'odMLR4A)*g o, Nk08ٱWfʮ* Wee51VZLUX]vU1Uـ b 'evale Rc9%]*8͊6*졊.51WW51VR®\Pծ*lUٱWff[ثG+7\U\P阊 *Z*Vy8Ub˦* v^(le[2KM1M8Ɛ-3bLRl N*cN*X.v S.7lRa51K銻1]1C6Vb͊tZjbʦ*ᚘU1V6ث*i*qWS18u2J죊[CVq9dbL X¶lUbaKYUvmqǎTۮ*ӅW}r CP¶So.#6*48pl )V ^RL]o**銵LqWS(SRL4S,64X.#LRHŋcăWs)o,]:dPi5덫Vf8c+ Ne1=\2hkQo+늻(0`WS7,Rf 6*]/lUθ/+bƓ-V+jbf]p+c\ *+]]U+]LUcvbqWf*콱 쵠-+vU ƕٸl!]XثvQ;C( DaWebfr]8]8(Wf]k], UEqWeu—c@ -\ .vn[vf]+ق .ǀ:bf1Wcup4U lUEqC)]S\UdSv1z]ˊb6v5hqWc]l*`8ث]v[b P#lRN*A8vR1]U".*a®͊Wc]7$;;@튻# +ޘآJbB7—eKRqWfvfen8"x®+]9lv)+q]ijqKJ,K!QWf{ ]lUqɥ٢O]1^;#S|)v5zPbcNi]&ٽu8٤co-kƸ@[v&kοw]DL]A7%5,D**{c}2 OL  iݙc'c۪K']۳3!mb0] *q߮*}v;Gاħm(v6V҇)%, 3Y9}Wc "k0+BU*1Wck2c];PVvi3s(Wbc W;(ǽ Uآ)⸫n7؜uJ]ӱoHzb^IvTB*)A]]WsrzR?%o>!.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbkǧē%Ppu]vX‡e* cH+vX5Wb,j`Wb*]Plce3S$Ɠ0J8٨{KL*w1LU\Uق*(1WbU۶*k9cC]Z~Rs-~,RG;(ӡĦqHvolU8b=];袛]lRR1M\Uص]biB8lWt®% v ezS;A es]:]3M)#b1|0iSziP]d-]sj6ʒZ 6ъT—bj v+ w^ثFoc82 ?lRhzv銻fhҍvhqU.Z(0!ؙ)Q.ő*kLUYbq;]>˱ǡ.Ƶ3*4]A*nP#}qC WcBLj.Ė^jyGLU`M,8xb]f‡cv]ROen]W[+H`eu~ YL mWcoLj-p62Qbv&ɽpc7—eء؋C@0%vZo(v`˗v5N e (v痗mԏFCG!&Hڟ5dVC2B+y)Oi5dxRlfo妦g_2PMM`|K5ck*䅎jC9s{䭁NdPjqrH^2{c‡eR 6]C] v8|Wc* 8RqKL6vYݙTw4kn;<;M;71M;1!]qWc`: v"5+]^*ʊ 's]xbˍvSPj5: XƕnaWeQڇvZ7a)vaG޵*K{JPGvW]N(v>1KG,6\RU_PPPvYN[Uߦ,E1Zv&A+Qt1Kaq{Wc1*CD^Vݔ@^# (N& +v®ƒhWcҠR,BMvXdZVm4aPȒbbGPKn TS%heOq]iFWe,]JbǠ+w<\RSZPM߉eyxv9ejP}Zvg=@;2(v&b;.-.ثYKR;#6]|Uؐ |1Wc8_bbFbX5)LRi%bXY]KɉXO> د͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'??ē%~,T]'eS bW/;0eU@bF*ƃ--;6vU063Sv^5'] ])w|U k/6*ث)va1]6naCʮ]qWeb`VWvcWcNv]p\U0!b#vb1VF51Vb1Wee`Wf8U1qWe:}0%\+WWf8U]e3-ˮ)o(\RvQF*bƑqCMf)vSb1C늻1;+"](aWf8)ҷ, v8`KY;qCLUGvX.C Va ͅ.8qhM!.@mL;00%u;dHTECNW&Ab2ɹw#*`cnBʌǖ2!أU:t*S,[eVفUt`Ec[\2]'B2Meq!]E0dJL| 7]*m++c/vlm-f#vY8WeaWep%𫫖EZ]4c ƕTƕٙcJݱWe.͊6(vX8`' ]']3bjWS0]b?V*7[DNvK Y#9}hg%ڹM2UٱU.,\Glkl iz燉*'BGK-8c&EӷN{$i ^ᙁi i27ħolRBl'>$6L}GLTd}\}WSlUcV9FثqWSzb_Q'S\ LPv(vlUBLu1WS\R+(-1WUi"@% O/ 㰮*xƖ ,Vݕ$ (i]$᤻ɗ|Uأ0a WeS 8 vjv[G61l,\sbJ{ WbSu 3TbeDL 7劻(*|UPǐv5j6iv<  #HrcArU~]j7`Π,'ч s?eg#`ĐkKk~cıEg)Go[|$4:'0\0Vjs'@KjSUЧ5x,-QiOGҒzA0Z"Vywr,8\Me dV~b 2"~;\+A,b![95,KʊsV9ۏS-d7"Bg?nqi 7sRf)]WWfCcA]vUҼE2 vPW ]5=1Av,^gw~8s%l!-~YSnx;%.PeVvd8Uzb*cWlU]E$v(OM%®,,v;(3ELUL)v1X銻-ڮثHt1Wf!">𫱉++y)(v[Pm]p4®ł|K v8"\ ]eۦ)v1ĦUHm;ܱ4—f 9wɅvn>—cQYO=WceUώv>CoZbc>9#*N&Dbjݲőg 0 0®nqWbVRI—b UЧcb&aK@v';7]|Kv6FhWcSlRA +*_'*OT=C["*QO0@C8(vXNJ]U]*]1`xȭ*xACq;Q## J V~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?G$(NrĠlUن)v^vU1C.˦N͊lck9V SvlU UvU1V-qæ*PL*Q[jV]5qv_L(vb1Wf"*)졆պcv5­ )cLjcJyI.8b(hU1l.jbo0F)urVbf#vU1We`C\QlU2[\U3\Ro1Z)LQM*v*죋 ث0\UGv771WW/k0.WfbS[[Zt51C8P!.jb^)eW[bʦ;6vYZb 0v-wjdBv8_P6=<2Y M R%_en4J3!r 1 `Y6R늷Lx5X e(p!i֛aVpc \3L(u1U+v_\ULU\17v^*[lÚ-e +;1]qWeaKJWZ7C[͊1WWF*U), 1|)u3b].UeUUWW(aCF*jvo| vjZH#QS$lJs8x"aƿ5kC` Kr?F"MVK0‚EZlq4XyF'\Jڭ>錮*3b[6wZ WTw뚸Zf=0ڸ{Hlͅ]1ShqQ L)(=<*Q۽r}^]KOaI*Y3IL?dvBOgOV;^yCP@G À _4܀|E0M&6h9+ hP" KGFUAq ę$FH"׫rG\QmEQhMp W ȥci\m[n1C"(X-oM1Ct\WGQ H8z`)l.$1E 9XU\v`k]v1IfSӲi4QMpL *8Y;,i8Zle3TKN \sVY%]mWNqxdldG4$DŽAlr=Ky)]-7W3T`b,M6۹b pZi~m#j&%ԭiayST 22' O @I>6*_q+-.5'j: xe 7t3' #^0k?AǏN%΃NDEU?^ >} (90% xBXL^RՌrǷSI; 7zVcW'iYI`?g2nL#UiCylܱK]qWfv4"fi@z`Wf;P~K|V |ivB7Z7RlUM)S*i]#|*qWe1K ءvXn7]\*ey/ tQ]w*|][.el*Iv9v"kQ2RTO|X[v[cZҘAnR] ]i\v$j ?g;%~4Nbb [ 6*7+}E%]pہ].dR%Q]r0oyjA6®Z%i Yv,JSiM]^Uأ aJWcz aKW;+/30UqWe8ڬ6 *zWv5Uq]u> Rh(Ɣ%;,`~.SqCPc<v5BkvWes8ٔGhPLPFUf)v-zdP^׮*΅ln}!bVNF/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$(NrĠZf8Uٰ+٫]Uٰ+ U٘V7o0-L v^*Q#vl RULk(aWe1Wf#ṕ]\*2Pe.UqCY-;*v^*5Y6r-f^)v^*VN+JUk**3bS*8b(vlUٰ+*[͊6*ثlfK*lfxክ9G\sPVlebln(*nb]v4Pj\U.lUYu]Ri\}qKK\Pn;0%ٱK Rs *S ]\pZU]\Z>se+8FNܵ\ - ob|फS(bclHY)l&N+Ĥa*q` LK 7_rƇ֣-ЁQC'l*9Gl eXEqCmMpx)o,eWv^)vlu2늺V(lf*죊08Webˮ*Uَ*ث٨F)u3 5qC*e⮦4mv^bqʦvV*ثq▲*ث27ثL vjx-E)W6 Qn3 4\IuPh?u0 )Gh}9OJHvI0Ӯ![UkJ,6P > aB2!B6;'C QTu͊, J*u[uY̱ۦ0"6]Z­]hثW ЌRܽr0!i6;$ 6Z-)Ieiqpt!)dxT( Tعq`y|%>T_1jƞo%魷чGڢ~/~_it!TMajwI} ]?2zIlXIT~N_2Z30:&ݍ' %&?NLL>N"0Y)e+L(~jFK\aD;S| Un' U8;bn]cVCbvdiiס\1](b15v2|$_8e`ڝ0x%&~O 1x?+,5y``xJM&l8ct8r>$eg2| te5ƾ͊yWᆇFv?kvT] !اN)v8:We퍥gTB!]R)& ,-q;o ]epb@:bĨ] IH銻]T$8UAʦK5s_ UF]C];WeW犻+ѱWbAo](A^ثcL ]Fv?ؔv'XP8rZW e#dbc}%7'`.Z%$1v&ܩI. =1WecR((F ]E]qw f8-cr%ƕ|X)]v<u*cCVblj4AXaWcQx2QJbfs˧\ gvSP-|)đv4—bG V[zbdEcR6]TqWc\PH]jv]AȐ:bfCv*CW;*~!v5٪Lj]F(~V#'Ha˦(QeaV L)lf[Z9XR^o(eTV8\ErZ\Pmqb0œb͊1ʼnuqo08PWe 2bnbj,Zœy`NF(U1Ctŋr,]qZo-Fk1ȥٰ+X Z$Ɯ)\=viM؎#+ /*W=*Z)m @<28 xP3'#haKLNRCbdPu-50,5*z}U^uq},a(ڄצ=C;[AÎ4:f9ۦ_,,Z|Zuh0W&kW\1WWUeV/nWm7\ժ[‡|َ;(Ue1Ml+V3W%knbZ卫.+,1NP Wf#Z 1V51V8qV隢cUDcjAʭ1KrW0pqqSPƳml mYs`Ӯ4K[uO--ev  rLMZr_Ij>ƙ֠H;4ry-%~f1Jv(F d;{~|L En1a-:)sNEd\aMaXlqȐl7,T7嘪+.Ot58}%A*wM0Wf=q=l(w? ثث`Ҹ(+Nc[&sbLءUV͊Jf[# om*f f ^xJgNQ[LD[mapoOO&2phućt}/(.icS又W gUe౫],,xCuNKi( OSU #<}P|x8|ɭۚlpO2|x8ӈ?0Hw'\2C(k8̿hO«˻ثۖ>MapB4',_4n~JO,#kVCL;#Rzç]X|_fD?&Њij?`OcJu yO7qZhȾ#ƛY#}ꯈ}^Q8bE=WU~*ר9Mg/e?qުbݿٍ S{S `,"aR?0PP?z߈Ӊ#yOSNuXݗ?NG .>s'O?-/5GmȜ"uc(1> _~UCOL4B@'e?_v23!ReO E-v+_늻-*WbPH1Wb? *N]qRzEp!F]m|R=#ϩ=*RBCLP@1WfF-]'^:RHbXAثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'??ē%CWeeS;/v7lfU,e`We*vU1Wf] 1Wf)6*lU]qVc*eUـ]Uن(vYC$u2pG67*v4e]1V[ *U5qWfvl(lP^(hebG.]o+*bf8c+o/v7 ثyXj`VqWeҘT;LR:Y8Uىm1K[񸭻(`;,]]UU.ͅ6ءU[3SYqvjWWq9bVs`qk,Ū働us1\P?<8P6 ,ri|6ZfCXSGKiv8)r8ڻr*҇ToQ%P-l6qHkeJImk6} 7hBEh) #+-A`'ƹ mDcl)iCC0B*ee0Lq8S-'1P‡ _q tjGL+6?\ tYFǸ9`縌K§ _ WsZIL6 ~?G ]~˴tK?qk0n3Z-rCwoOC^2/Ďtzo WbɷG,iw? .:?5D]SO Ő׋ oзcJO0Zu_ks"' /_MO04u/ks~??OLj/L_] [` z/5u7 L^3M4u 欿u 8X|զ|k5cgo0%͚x?_Popq*/=9ݠWzpq#<U՛ {O|@pםi \|asՊ"amDV-&?ir>0Ovr?v(?.d~/ۃ &! O,~\͸>eGn˿͸|7ʏ'ݗ*{'X07tfA/??ip~`#U_0qk͸`/XRٿ^90+anu0.Oߗ͸`/[_O7cG80OXDm> ?e?sTϞYc??xp~`/k~_g?ۏM>05hjƟ+oߗM~q_oٿep^0w_o ] />0_ 4dGՁM~UpldeyB~@8|@b-D6Qp;yzLcUƻe 1;8b0%x֬a,CgF?/5+k\WhC$L6:DN3蜞6`AQ3Yn;)d]@Tf; bnMvloL%*q nx>$% kL2 WjIFBB2*=oQҪ6ql*cT&-呶(Y  %qv[s<3bt͊3b]vlUٱWf]vlUٱWf]\UXcvVZV* t;^6U.͊LR9\yeSȶl m6FQE=@hrOLaq6Ί1HҬk'_q L('#u)g*#wo,khMc QSQq/ƍ +~?;5?%xCGT?/f)1) ISy?/1v~CHBke 8=6iP0)jk쏻6 ZTPlc]Eb1N"f ݬP{卥u>Y!lUէLUlUٱVb͊6*ثb͊6*ثb͊6*ثb͊6*ث`U2 Qn>C$8s!• .Ubl®}f8_.ޣ<ʹw{Fk[!V5Ҥ䭂aَ6Q.Ͷ;0.lv‡fLUk]1.rf v;lU@8R늻2bʑEp+`K]QC;UًbƳWeHbc>'ث1 vYEmK0F*S]Ź‡fbNv&G֘D UبqCX RkHdb, kNkF]0A.ˆnR줒\)*`IaWbJ bbC CJK/\Qn ~.8zjq[v—b9cS.kmvŋǏl l *|bO| @ ]q ](W ?M=!EH8Rצ(v4 =:Wbi+׾*Y=qK+]a 1CG'qW`%:UJ]U`j\U؄E =.H]lPmw1Wb^4୕=iHby1+/ӑ̭ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'?ē%CX͊vUqWf)vWLU f]LUن(vlRثSvQ[l ]beF*lUثYWe*3bQieR2l?)h7 ]p+٩]Lզ*nn`0+ckLRf®X ZQ b-S1u2aWfu3Su2*l 죊3u\Nj`VVqV$|.9\8j ثf+qCv`Ku0XO?B~C޺1_З}` m~ 8hgq}c%_[o?s88֊yO^'Yg?N5e(C|p WWuO5ea_N>8O]?Ֆ|14xJgc?ΟN>8G}j@7pxW'ߏ5bVCV_8/_A/G/\iV]kV"?.Q鏎Eq["c/TI Q?>1_ /=v9\o[)O0x>@L:f#inhdBSewW8I% F+oP(<2Di"""IjK#$e׾X´5(J1EWF d\OJ5Hv_L)hJXĝqUDj`HU+4YlEGGK\{ak:AV$FYhV宪@lzw JdHd,#X#OoaET}_eEiP[G݇mwQݏOQk%oo7nj8Xݏ^ѱ/^W/ov>!^̪/^M}c+vI?~x:X~Ix^~92C8b_fp-.vjSM1(WvUf83bf]AulPlUٱVo6*]jVUٱVb]jW}9+ybS mV+3Pce\#Q?T/fM?!7LT<>0GUɵo 3W^SxD' uIG/׈妢:1Be].RTֽ8~u,~g^Djm'cƚlDe;%kMP~>-ȁⅡP~%p#vV+Nafiƫ5q[olbk3buNlVS͊ۨ}awj6;+c5q.lUfJ,ƕjcHuko|զ*b++rj eJWrqw$~kyy#SSQ/Bl>cDQkL:i sE!UWc*bG瀫 pFwƖ)Qiwg(dGpXQd2[uSj=$hrWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]h6N&n{6"irU:b)SxWS8#RbW5B26ZU_*ȃ̱"v2qHV!W*ܰ7 p BE{sXs4^Y F{pox$m9k([4z Z|<=2?&E1J<5qnxu͊VW]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]LUX٩.SlU.Ú]0*ie_Ulv+RJd«n WEP,I ݊j !H5oD%GsOrbO$”k6(nv50lv­3}-Z<3WWqSqaeQa +qk}Ѿj"yI"`yK /Bcjy%ĄomЪCOdf3k$_\T?Ѥ(`m~gt+C(> ?YB5N{@%TcAykf獐d9ESbD=qUNU5|*qKxDRzLv8 0\Ivf).ğ8ن*y;N1WbLpu]F:]Uى[\Pmw]C]рy®zMv%A#,]`CE銻EM v=@ UMp[ f~UƢUٖ2vX 1WcV/HTv9X]PHM+(vZzbݎ;PkS-.S]c!=1Wcva^;,]jbh*J8MM)v\: U٣'j U٤p+Uvge؏>-F^ U+쯞vP ]Cm'coÅX@qAv2dq;]hp+4Dx(v>) H~T.ņ;-2눲 ;G%c}r3Bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē%PzA]WS0]LU8]Lإ6*lU٫6(vlUٱWf]vlUٱKt'K7vn8SusRl)vlUٱWeUs[LU٨0!G+/;6vUqWe 6*2+u3Pb b n(zf*책.qWebLUcsU|[#/(VUZqV4;f]1Uܲ/Ch\6SL\ -"B$mNmO4k)&B/3 r")w3}aJz?#%7NWsWڢԁU9ƕ)4N*7 \|3W 2^)vlp5qVء.͊6(vlUٱWALثT͊WfJf[͍-;64S+ 6V\lLJԳ7w1?jom@&saTy>p1\UHC)1J`v8 UvȪ@⫈LU`*9WbW)q%!|F_JmNm uƓ nqZpZIV4 *>4мܒ =@oʔu,G9/LhIV#VlUvǦlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊~jĪ^Kw]4+:~X͌fK #\ 6%hMd $ R-FIPc(bLUN4tR%[S^XeViid ]DaB: ̆Ki0e{⠩mCdb(iC5@*ELaz늮3N*8ኻ1Cv0PKT^UP7*8vQث6L)vRu]lvƚcс;3N*K;-Īէl)v=1v\tBx8*j|GlPV.";FإوLPdgU"p!؊CLUoJ,!.ʙ.IB-;)9 —cA'#[ *;/P™Uؠ4bf]4\ r' %Tbƚt]˜qWffLU*ENvS/!L)v$'¿* eҘ4BMi HuzUˉmӱF[*@8H!.AevhJ`튻dmE;$.F)v2]Wv')p+gpTbepf4شD};-ָe{+:HbPV7_#+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6VWf\ إ٫,aCG6*lR];6*ثb́]N2y`jdCثX+b͊6*Z9­U@Wf#v^*i]].bf]6vV(vl vlUbf8Pp8ثt*1 eb́Z8PbƓa[9p[ʮ*\T(k(⭌i.1 `R; Ô(Ay_[h1'V f 6\)RƸ*5#AJ q"R-U6iG26l[T] k4⪋q͒U+lU͊UٱWf]vlUٱWf]vlUٱWf]vlUٱVh녾iE`2RC 1e$(gԖR*_Jr>fkHݝ,jqZqJxC] EUcqJ6TUaghe`V񯺚bs)u;fp!]zWW7]*a66*Dli{pSU{d YYw@'&67`#|u[*+޸8{dR*͊jWW6*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf\ nثaEj0vz0U +>$$È #6+h e,wL(CHc J哊+%X+.ڻ+إ˦6偊`\iJY)E-q*nUi|`VS*<0LnEUQe_LUL lUٰb͊6*ثb͊6*ثU͊Vb͊6*ث`Wf®͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثDZlUsblU͊WW6*]\ث0!͊UiE1KULUa91U1UUlĥU3b:VX7zbV?G!'֠i@FI,(QE 6*ثb͊6*ثb͊6*ثbf•'_ۯ V(\nxC>ERSuj8*h:G2Pd>VزߚǰW?B W6k+E0) 2B*CT q* kVJcG^LT VĀ6]vf-lUـ(1WcI]ҁg6]oqWelUبU؀E1WclU Weq{b2)qWfTlqKّWb|RLpؔUجNbqOuI׉Y h|%]GvQ.v6U+/#OA])(h:dJKQaC(KSvY` ,|Bv;{f4]t늻1*p$\RsID]C](v2XIJv.j6OQ\@5Z@\B]d] `VbƄP8.VŸ]YS*P(&v$Ǿ*zˆ9(v#v4[lUև8&>6dKp ~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y62A ]xb͊/jWZ͊6*ثb͊6*R*jʮ;5qVbɼUXٰ+VvSb vQ8UU]ٰWfʦ*ثU٫/;+]0[|U٩[P'-W6*of\rc;U6*lU6* ƒpSvj`KD/;+ ]nxV1Dnq>2MHLBVESluE5󕹑/'? ȡ/%>إG|NZd @NÐ)M*:vF!\OL]\i*wƶ*0g1«NjbS6o+ Lb^nWW6*,ثf*͊Sͅ]vlUٱWW6*WPZLUiUh;wՆ×jr!"SԔ>G\-|S*ܣ\17UIvRUR,1ii4rM1Cj0V"(1ZvQlRe[s]J#+4ن1KvKhၨ(&ЗQ +\io)/A`$\ Adŧ݊(F+*w&_[͊6*]\ثusblUٱV͊6*ثaWf*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊LRF@U Bo`{vL@#nKр \i1bʿdИJc\(C:9%Q+ 0UL  UŎl*q«qcJU5N06IFC9WQBl8BV&7UOV٩ JJ W=Bs Kc\` dsb]vlUt®͊+|UesblUN^*6*Z9\تfͅ]vlUsb]vlUٱWf]vlUٱWf]A[LUZʦ*q^ V\PSV{pjئWm]Lں\qZF_m[n8-]LqV㊷2h˦ VS r鍫YTռqJX[Z ءcI\ءo:taJf 4)$H"Lj?9yB|- R:bS$ī7N3JzO\Uٛ{v0lv]Sc*nUwvg1KP]MFbD7c\PREu'CDZB >#.YeQ1; `WepZ]}vQS (v;*FJKG@];)(Q]zri"gusҘǐry6% v^*ثbf]vlUٱWeثYWf]vlUٱKb[lULP#us0xӋ'f*ءٱKW.Pc)o0]p1vVإَ(vU1d]ʮ)v^(vlUG+ 0%ٱWeu2bef ZDVlUWe# fl#k+p͊v`qWvk6*죊2뀫Tkfc^d8bsp ~Z.)# ~ɒ˕\֥``5 vꤨ鋠ł]tnGn8K0*߮]2*;A͊Q…oqJ@b# DeaWS6*f*f*fV]#j9j9ntʦ*_ٸsqj,p*n8U\qh.n8ڶ]1V,-vT4Z[Rs .d5͗y >:ra\,51w\: )p%(KyUu1j`CEqJbzBu]urvQ-告LRz)+n+QL1 `4.|hwH$ʈd ּ%!%'hhvjsSLUt]SvP[h#SdY[ rCxUG ]6vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vPZl[esIAX-uIR:|X05ª.H!EXª-0M"/k+$bW[V*^*Ҝk-w7aDeSU-r)WI2U|n`b|PTȥf+fUr6L)UZ)B\ثyU]0+b́ZlUͅ]Lثy]qVn8)50yWf]hf[͊6*ثS.YTlRULUajeSlb,{ZNjb50*[`qU9dWkAF*ze+Li[囎uk*qVn8yVl ­͊-\(XrVF)o`qV(YLU3V8ӟтnGn8DjN~#S|*^Wf]vlUٱWf]vlUٱWf]vlUٱWf]vc:Ʋ$ctaB2Q4n"X%3yB:]>s>J4/+٬` =mi8b + 1ؒ)v_Z1WcpWeFvdJqWcjbv&܂lR|F)v3u8UPz[銻)v60:Welv(إؐLUdv]L 쳱vZ.u+aMv]bc ]8߶.Bҧv&Zkץ0+8NXVءw p!|A]v$=qKBUpM7)v8H]u(F.Ɣܿ| $Bv6E]/v1ߛ]Kءٞv;@1C7Ν ~@:bb*oI$/\UْI8.BZ1Wcj1KI>1vv>NDc,%c}p+b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%3b͊6*죊6*Pث UxT́]Lث WS6–W;5qWfVLU3\UX٩,m8yKWvjaWe ثvc01.;(vjbf]p+lUث< *WoeS Lo+ 6vlUَ*ᕅ[́]v`0;1\4 Up4lJ՗?dU9D csou?'@{ ח8lZ/玍jk% }7)r4UYI0dK$M3odl ˦l(j5qUNUp%UNV*jaU®WU͊WLUeu2E+\*s`C*kQrU4ZJf *tHk>9+cF[(4;l(q")Q ?/א4W3!ɮLT+I0NMké]w®d#_8THȥeqiWqH\6rz 'E#@v7哦v>8*rM2p[EzdUv6RؠNثuZpb ऩqFamO\ >x.89;!*weK,C S  ze bM\ZLUW bb ˦(R-W)uFn8eR"뚇 \تaVo6*ثU͊Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثbv8>K"BESݞvɅE܍F`2J&YA`rHRaQa-8k-e*-ٰٰ%ٱV0ZL%W$r4Lr LUcXS*LWYN6ƒ8W}*@…j`UE8ӅW0[j`Cu͊]\*VWn0]LUCZ,;eU'+FdbS|*˦ Vr鍫j㗅 W+08{e↋ 1Ve"\Hiq,+*Q"3bUC.V3 } LPw*f.VlPV.#lJ[i*3S zfث|늭b3 *lZ9`b5­mQo8 Uo<>87r@[>5E-1}UAS]vlUٱWf]vlUٱWf]vlUٱWf]vlUٰE5J'D24ucx3'jW?ANr-|Tlbs*'i.vnNv6avoQN]FdaWbqa]#.z]1v&AQv4ͨ1Wcv9Ufg᲌R쥋|P."1K:m\PNF1}].M~!K1 Wb1nU]vb;ik`WqKoجqWbc*lЯ$Zbٗ`We$WeTea;bb(jc58Rc]*iq Pl@܌ YU٘0v7XLRP; Px*q}pYxv$e*<1KX*{LPiA 1Wbx3v;lU(p+7éaSA]+.!=1C6W%#qٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%3b͊6*죊];/;6*죊0]\ UٱWf]qV^/lPvSb]\RQ͊/vlU]qKSv^(v7;/,Wf]qWW51KCyXSvl*]\W1V LqKZpX,[G[]qW *l ثqc]1K8u `+M@ ΍Eh7 ~rqyIc#*r2AQ0?B4aU *6H!ITsW)0 RPk+vX[lUi…,WƜLWQɍVYs«Lp+Ax*Jd6EqUU(`UEjUUqU@T[X1Uo,m0yz/8wS *hθ去7 ŊM\`rNQ8VVLP>U1U f*LUܫaNW(Z7Z-#/ZF`1UiTLR,q5S 'Z˶jaQmWrհ2Z;p6NٰsWq9U­ufj`U6*6ITA͊s`Uьتsbb*\*"4y\M.nXV\UMYGJxr)B3^Q 3r%LlUU6*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]wC][^™((!ls5tc55̑>cO6A<޹ep."Iu+SSQ v+ZP p%d\B/cQ1K9"Rj:Wcː] I8ء4^8>C Âv"l*o{m!^jF;/-*إC9 *|AľNXCGNU؊GBNv=PʘW ]HM)v)by6%3b͊6*Uxb͊*Wva](vQ8R]bc*f8Reb^eU—eWk6*X]qCWe]];(1We͊, `qVtqWe⮮jaWW(Vcv^vXSusqv^٩]8[LUٱWeaVlUtZ$*ceqU6߾6YZ`;~a6voBAΏ |Ptfwsb(* NNVVi P즈Jc*u.I3!ǣ*2Ӯ(v*[\Ra(v&**N@BqK8y/\ …U٤(>Uش EWc1Wcu]HL};QmC"Nv6F;bc튻VvQ!v|Uh(vc|UؖviR늻{b|>r} aKw ~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%3b͊6*ثb8WvV*ث*ثWf]1Wc*ثULUʦ*lUG ]/;/vV*ثb͊/6*h]]vlUt إُ\UثbsaC)lcqC}evlU`▎j-f8U—eUف]qCc50+y@*2]1V˭1W ]Lˁ LP쮆&>Qs66iPo?5q*گb ˒;rOb*b~W:t.c⫄+W+Cfz}Lpª,Ƨ1E(ȉ6VC+L cJߩWlP͊U˦)ZsSZsS7UͅZ˦E-(aCU0*jaJX$!ݲ䂡Iw|ƐN]1VF*s\UJq!W.Z'vO!;)0<ԫh6ăqG9s%2l(vl 죅[\UGlUL9 Ur0,L W4(5Hl \&Fءp8.leSo*6*UkBp!8e!ݰĻ0 N~6Ŧޕ8xU}ۧJ|&l^_K2B(q*CPrɁ\ZQ ^*r T '6*P.8튩f[pS+w \S.Y+l6U1JX7 MCƘ)+Ol*%m`b\b\jbLnͅ[ b1CpvlUٱWf]zm7 s٣ֿ~aq% R NSrATs *˛c  \cx3bHl*lUٱV+Y«NT*nsbf#p %zLU`UE|8U_6*xGUdUYdʦ*9G  % P[,bF(vX8Ӆ] 0+G|ZLc1]\0LUHƕl1W2SU@W|Uw!@Z;f㊻U|Ra,/*=1`VճbbGlUko 3br͊ sb0Z'.*6P["LUur[^*rVjbtZ2fኵlbqJ*qPٱU*U˶b0%]ePU| bE]: UBbJ;b`a׮ϨSv\#vXA(0ؔ8㊻.N,)M+G)v-FVߦ*RHqC1UlXnzbS\U늻v5ָEN*#hCRr;`6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%3b͊6*ثb]Svjb]LR;51WeUxbZ\UqVWf0]]65qCc5qWf*.]6*(k1]QWW6*f]LkUٰ!٫/]%٫lU\U1C(pPvn bͅ]qW 8mZZ↳Cc3ʨ7 Yyti@igHL5 .gj7Y&pNSbM1.(m+(1Kqc6WcV: upɔEqU!]\_p%r9WSp*iW9|r(^U1U♱WovZUqV-P.lu(X+/czU"r*Vg9`d, R\W+urloU"GऎECj>a[,azz'O`e]1VUfu3aWci/vlUؔ*8Jؓ&Jؓ.S|\\$qd9G Q]]_ UV3Q\hJAR8]v^)vlUP|UtlPblhdق,ϗ^@9=ho4gs*1f&bpH":QOF *sWU 4͊La)…6$e ^hqˊUs(*je0LU%s )X\<1C땊Ue7L*6)Ep%RqqWTU1W uH#mZTW*eyN*QFZkscJVǎlUe^TѾDL>ި#F" ǐj(pTxUMA .1˅T品V« …fV6*2k\9``VW\*'.rd'8LPb9E+ՎnWS)TWN@8PcQ_("rzQL*L N]1CLRfW7qWeSjLUU\ lUfp`I­eaWrj`JULPsS#]]VI6q͊f 2ULu*ؐfF)T0Z (*Г( UR㩊&LUo,1Ve+Z cqU|#.f1WW2Z(Q3UU+I Q0ʡ+vPq P /lUL`dwXxP91J`JdSR50ڬ!SL6sj\qk|սyT®LU]5qWr͊\['5qVo6*Ԯ*5{bO0_„Ł;A!NcPF,*)7*U|v36=qKa*vH~ v&YQCa//;#R`X]d] 9!(v=[v8]hÉqW`x"1WbO.ƅ|PȌI]s%v')v#pLd(;22 Ol*Ud^T1Wb*p]Tvƻ"\R쮔)v#?.{WbJز\Pj1Hv9p*c bc[N1Wey6%3b͊6*ثb͊6*ثb͊6*죊6*U٫.G+k6*[®8ٱWfUٰ+bZ͊251We͊*p rWcXaK U UpU٫.Deb.] ]ӳLP8vn̮@]]\*U6v:P1)vRqM;;zJLۧs)#[X _eɀ'w& "!^T0!DJcB& h3 RsP.9qU#rA eT9OØJPẃU\U٩ȪJyWsLU[Y[LUtlb˦*:U;emb9T*Z9XPU9U*b0'B}?ŜP73LV"!]W5Wr+C(0WvUqWe͊*ڝ+.E!a%E8UQN"FEW LJ840-L o(V(bb sAq)-00Ŝ6;+5<:JӯLhj8TV ;Yѹ#Mo4/vK:eg+1[bHYoAcuK|(1,Mq廛QRPO0)JZ7x늩2늶bT\U3W l(Qa1KdMp!r6d4®fhqU•c\1K_E30/G޸ѶHPU*rzcqJaqWV*VG ^`B|i\mUSaWWbcjN;㍪8ڮLU#Nѝ\X ֬8oW\I<+,T{'i㫊8)֘UM6*v*rUeU2ZajW 1Ui\UrJc+@eS]V*5p*ٺVe`UƑ[cJ2#FJ,Zs8mWxWeCG6*)*U٩s U6q1W\FT«sShZ18i 08^ V+`0+\U3`Wf\I͆`Kk53PUZ18*TP(m%jURSf͊ 7^)F\ Jz\MrCM6*jxqVSzb0Րp%N^(nG͊–ZIkE(\T t[ȡ,Ү{:p 1FlҵJ<һJcHoJJ,ƒV1rJ.Pu1­pٸUܳq[51VlUզ=^5e7•1_z7!L(@6񮢴=0 ӜϾU6}zv@)s;?̢~9w# MƦP1­չO\* 0]6]]v®Trv,;(;K U٥QzWf% v] >ָ^N)v6؂JBz *:o.Ƽ~䤓]FOr1Cv\m(TWb^]!؋Ny# t,| ]=UE]qqRd2U=zSNĤPyb$("bc,Ws*L{6ظqZv'1+ ð5'v71Cɸ*Eڽ;be|RHWL Po8٩Mק\(v',_A.ˑ du܌UVlʼnFPL;VR\zbe]ҜlUKn]G*bF6‡b 1Wb=0+%}ث].T‰T6)q%Gı+_#[Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%3b͊6*ثb͊6*ثb8XUٱWf]0+Cb͊6*ثb8 *vc6)v]1Wf.͊vjc f]5ŒPccp,aWf8ٱWf]Wfٰ+6plV1]`Wf*pͅ]b$|4ZIikPz0܈yaW8h37ZW0CFz`Ci202FLԦ*ث1U27 (SmL(Pl _L WUWr*fٹY|4/N4e*cW8)WnP4 Jˮ(X0e r! J[.Û jX)$ v$ 15=׵_P?J 552Xr\ 3aWff]vlUGlcW108 BIHPE0^ux8aJEFĸV0lbbM0mq8k;71ɕ3숻6+'f;+(v_m-W f[ 1WWYt' io*-Ar4;~NJAJǙڛPɹ97a_/F؃,mOes>N=J1hw C Vu튬w3bRriUfVUNaV\lUw;54DwҬy+\2U9]b9G\HUU+A\}0Bs+Hڣ|Upc`UUp5ƑWSM7®]YH?n+ k{3᷇.Ot}c*+Z2Re8BsaUsWX5pҹcu­1UqU&Jf"PrZ㎦p f2*e)nC\]2*,pl^2YJanE7#$ٓ|ˁ |r+S0prNVw隴 Zk`[Ǔl)n*`PfsኺaW)VnUنRvL*'+]\0+D㊭WUT=Ft4-UY镊\تiUccR啁#Det[-1Bfm%\ XܰޙV6٫w{$6p;lx[­^`:\ciW sb͊[51V`N6T–rʦ*ILA*xqVՃlV(\|▙w3)[,|֍ W ,!n_3o8()o-*m۶ދMa[)NrJg&Qˠ„ar^]0oՠ#  cUڗ;Lv:W)_mv]Pi1n* ;6(v7aA]P5r: v%‚w*pE{~H޴]$PJ5]BA=pvTlYi({bc'B=C+qqWeL!늻.eTPl0dUgQ(v &UِUe )vSGB튻Abb#CձWbrtU؃kX*֧H!+_#[Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%3b͊6*ثb͊6*ثb8RUٱWf]\U٫\U٫6*UٱWf]bW/T–S;/vjb];6)vlUT]LhT]L*W|P쳊2Ky^*ɼU٫`We )v^;6*i8U*\Ugvl UٱV0beU1,p r ZYZ< gI0|O,F%Zw5N*0Wj <{aBYXJ5zf8bp)6aB718",bY銬-UYT­Fl>b0Ү0R[p*G(i0;aJli ƐeS|î(RcS'6lp8P * V)o  e ?+tկ$RDž{d`k,#/5LUUٱCb8GQpbS ePqpbN19RJr"P[8P5]\hE`O*a. +c6s[JŁ&*.jL^)XF^,VS,bs *늵JeWq}늴7LRpr*\Z*b sW+b\$<24tzaB۬g,P.AeSe*٩WS dưU8mu';8[!X˵e/<- `Bz›fUm2u2 *Y* PZ+\s`Vf-d2f )XS,P‡+ 9tj⭌Uur``Cup٩WƓ8i# 1ߦD!|uc`J׾jUeMUث52$ZӃq|&k_)hZFOmhk+Ur3Pƕhm_@bxr*,bEqWf銴lU"*>٫\ *ؒ2blk sblsPQQLUƑ\RSl0* v(Q"DaVZeSU96*(UrKy Slb皘`0ۜ1UbkWS6ZsV*La^ m\ WhqB\4+0CvD)TF_l2XB/)J=Kw_Յd 'eOs\VLw>8L!s­Um3b\fT8mVU0\3bLU-9«HWQu\B aU22]\ ]\W*Ui^1«Ɯ(h|+)FpQ1b 2Wb-F[.`q--,)ִJ5\+S`rD7|rUS089xUJ/s UrBY!WVS#/ m­s˦W=qpsW+~2qkZL|Up9*ثYl!Z$V lpR!ūSlY44J%Z+yXu͊告rVXZq\UL bfU6\0zrr ˭p*WE1TP5\)w^e! wӴf{Mr`1b^YFH *rfd« UchW ObQd>9q_8S OcJLi!`Nb*NWpqS%xIq!Q1fa'EiTҠcP)aMH}9ɏ}?,^8 )6d |匃!(&JlFP\lv*}Q4j/&[\ń˗#ߗ %dp"u͇7 59Jւp5ƈ< r]bŪ1Wer$w.BW$x<Ƙ0+Z WcCS*^vZ]|RmHjO*humbcۦ*ԥvlUؓj=<1WcQ O]H Rѱ)LPLU*jNvRQ0-UȗӭNSԦͅĦ)vh~B{bb%D\R|~l]Ȧt..|=1KzP I]d~Uu# U؋HA. 鷇BL*HU;v.썰5;85]+OV1B;bn lUؽ7Cr@#VٱCX;MFlRMNJ`KZӦ,]7jN)qʸ#W xG%c}r9_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɿl(16*ثb͊6*ث)vVvlUٱWf]vX͊6*ثb͊51WfZ1VWf]]6*b]vl ث*ثٗ;\Up+Y®.pvlvlUٱWebͅ[X7lUb9`N^*Qqk2WwŒw8 jY8|t//Y\+s kݙQCz#OBLP:"mPnVZ9U*xXW9ch匒Z9xث%x(leU lB1&•EĎ EĘr^05Ő^2žRq 'BMJhU⮮j X۫q^bNXJ xcH5z L $͆XeaWf.͊6*­mMrVQCt4it,ȐiN]@|kR'7u$.O2`ז=H@'+tᎨYxmZ ˮV6sdF^([Z2S8LUipZ[(Vƕi'1ƕ‡W, W*[ s2 +R]mL};cHBƲ"BQ횔TRO*_0_iV<eF4@逪-.a%-CO94D?IY:+ҧǾQ8a|qWS,bcV͊6ZNV*%ZrCYxDeUi aB …"scnG\[͊l /\LUU%e%Ygcm(UcW W 2ll*Q8~cbqJُLU:(b偍%l#^rÎ8i:bkeBw'WlZaVW*PL*͊NXZ&*2US2Wp*ث$kZjblUYUj3b88 "%QUժ+AU1VS|]ʦ*֙xmYL&L*p*6*vq=Pٹ*69[u#3`JԐ eRvr(зH~80{ɗL(QiNU0.X"zI VLUS.LbLtV3 P͆}dRqLSh5)\&DPcIBj 3&WEYG8ڕ5i5ht!A*ޠym>jz`w^' BS6JcN|1ݰG$Zz^S84/Wob< Fe?oi0~cNi)]$O.=;dvP\*챷L ~*p]ȕvSp+blUq]1=Bym*85;*|U(^+)v""`n®(:f;|1WbrzKP*K0SN# 7ъӳE0e'(v'y6%o/vlUٱWeR*챁]qKb͊6*ثv^(vlUٱWf]vl*],bN*ثb8Web]qWe͊6)vlPإٱWebevlUGvVv^*إXWf͊6*Uَ* b®͊6v^y8{4M9R`6kPiQZ דnhyϰ$ՈQ%) >ٱCH2;e`Jy*Q«NlU,Bf•.kN@*rBQ 2­*0!ٱKu8ـ­W1́\N;jX͊s ([Z͊6qfV1z oyзH{kcnɿ-,=k.P(~񐃾d0zpTaV U/ 1UKWf[c[( 8%pqJad+Uqldbg+WL[dRfQ\rh㩅VqKqLUW11V3Uف.́ͅ.͊6*ثb͊䄆4•#a;mbeAة̬2kG?Y6. $+n#F'ؠJ$ٛv(`N;nBCppѫmWeWo܌Uى\U؜]vnDbN*u,w]ϿM2r82NUbaF7ˑaWb@b^.bݰ!ٙxCv6Xˡ ]䨍F+]q"Zn•.D{bb7zbb ]zT-B*bj]3TbU@#®z@*FIGLRlq^WfUv8'5*p+;p"u=0D^:WbH;RV!bŢG|UذJu‡c&JثFnp;c](\RQPN٢|v)ΧlU؛qPIO\ O%+/ӑثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6% v^*R] +vX8XUٱWf]vlUc/;6*ثb͊6*aWe`Wev^*죊5qWe]1We/vlUٱWfʦ)v]1Wf*ث`WfI.\UٱCb́]vU1Kb͊6*ث*U68.%vU1Wf®*Y=5-oge2kT"?xplҹO2XfBYɡJFȕt]r%\i*`UA(VlU, P1ޙLk)^lrmiAq$]\­W50!1W:14« *r+[=qUzb 8l c)[PHzcpETf?OrWҙv1_$i?PAMV?#W&f®1W*XV͊6*ثbNvQW*cb*!XJ`bq"03\1`Bᘭr(lc V[82aVإx;+*f1Upy.́]be]bf͊6*%vc특I#6iV叄aA}7v;+r_ iV=Kգx&ӿ0br}@6#SH$Xѐ1Y {gQ4L` bz뗁V%QlBͅV008UHU4.UMlbW9heS/\`Ws'MJ&n8ҵeK&irlN JK-k'R3܁j%l JY$wpL*qVQ^IVʮ*N^V\UUi9xP^1bVثaVV[usbˮn]\تsbK`ci[/ YHoP*gLR]0Nl6^]5q*NXȥYNVhG1P+q05‚2銴lR6-9C ' 3bR ƙxp9Y-… Y*9'QbrJS0r1B]p7C\iIT[Jf53o,%Yxs6jW sL 8땊l o `aVsS癓"LL9&J+H/ d3=]#~h`f}늨XNy5 ^o+v^*vQ!ٰن;/;(eaWf]vX8b1CWebf.͊\Uʦ*UٱWf́.̈́+b͊6*v*ثb͊6(va/]pٱKbeaWf]͊6vlUٰ+)vVvX]͊(GVq0YUܩß-ip݆W92H߫ +3_ 芴fn\C-dm@{d-af!lH͊WG6E*8QX UZˮ*rUE'U@#哶*ƜZLU ^68uWb2JzVf#*3S L 9\pYF]1pJeS #Q\ܠIn'+qCO9ܾOZk{b(Q<G+bR;4sbf]vV*Ui[¸lRN&SJlkGWĚv1v:Eۮv!P;eW|Uٍ(vTZ.Ƭ|vRn~0ا b5gv4VSk]\t] b<@Б `Wbs0G ثF}*l^?jveguh(+]v;C#s's.hR+F;X U٘]zev3t٣pN'2;aKqK01a](*c.\4]Yvv-ю[beK $.-E]`?x~6d(aWcz&1Wcf)v A8JcT1CM1We;RI\P㏐es$1y5 ^o+v^*vl*ث`Wf]qKb͊,`WeebqWft]Yt‡W51KLUثb͊]Wf]v7vlUUٱWf]vlPث vl*ثbf͊6*ثaWf](eaWeL ثXeb+Uw\~>94ĥ8-o nyocU~}~oa9+6ZBBk_u1Bo ZNYc)E(,bw8͊rLqa!Ʈ*(8酊^zczVWS(UӁULԩe(j.lP6*3SWq'crj(Vuˑkbݪ0r򝁿P31׹̆AƑ;,UٱK^1CG/k6*ثb8yGbS U l64 U6LU7QN z`UE̢8K L*q4E $˾)lenapG;aS] Ү*LUGvV*ثb͊6*ثb͊6*ثb^VGzem:Z!zSAVJUӕzN#ҟB@œ/Tf^Ymmq bx×Tb6*aUt9XV͊LqVثbp!m-44ªу7!(E@8+ '[qA ;B0LAYd% ;_Ȅk [is`doRu0f?lL^E=ot7̬Ea4Π-58$0og@[vᗪW7= o~1(vWv8V]銻3)vQ )l ]+o)voO*cq(RhsAǎCK ח\vezaK- m EqWcySvUyP컎~p+0䬋mQfHj:bcV<6]@p%؊ѫ*y$.o(v bne.ǴYT}DdLUرQv`j1K]ZSnU7b=v]==*MArXU؛%8źb"v$ 4v9TbbRN#v,q39 *P(qWc4F Nv(o]oPGPƒv'RaUٸ]zң8-,n~QĆ%X~9د͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y5Y ]1VSvl 챊Kuf]vQ.]50 P죊+vX]5p+]YG76)v^(vlRثbeb.͊*銻5qWf*UUU\R] 6*ثb́] 6*ثb́]]͊(`WfvQo GLXWtD!u;g9Lv/k'ˋ*fv< 4!E^*i͊Z^ӀWLnW\Ucm BaU 1J18늨)o|\1H%i=1VlUVVԮ.2ȡp9Vb͊͊6*ثbfWuƑC SO*BӨU,zdgw[/E%E妌R~@?>_͕% }r S,paf50.P,.*8m5qUsW '(9WS5)^u2Zj\*  ͊6*ثbf]\ث\Pj01-0En쩋+yL p͚b4b8`VLW,4M6 UJ1p91qlhlU6*…1bf8b.Nj_ՠ|r®lRf8†08Uap*3bqWkQzbE\DJlU2*g0Wҹ\R9V`b֧s-b-T\5 2?+n b:)s*/SƜR#8ÊqJb,W*eRCvX\sr]**>Yp*Փ{e1'U>}b'GW* I%Mp!7q D'd܅$ÐDL`Iz7\HTV^#b+ >ۦeqĝC!;(2VS ->{,J) pdr'W!ZU;3*'Tdfc].TѺaKe<)TqWcyb# 4r2\UůJuj+u]*w.ƃ^1WcUcEv>X4SC]`|G 0v6Y6*dVw'*l`1إE0v,p!`;%I쯶W—fCkOWf)vlU:er Wve])]c=p!v4`:Kk](iĮ$LRU_ZUMXkRqWb1F'|U|SlRZ88ظ v‡eLUe|+UدQ®|U)vdn; N"8ˆeu_C AX~91_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6 ^*lUGv^;/ ]]Cb͊]qWfWf];(]1We͊*xU٫+v^(vlUٱWf]vV*UٱKbʦ*ˮ*]6*—f*ثaWf]vl UٱWf]vl ث0#vc\? GJ%?FCM 7ڤ?Q_M3\\/X!lV^,Vإ;c0*!sUݳ U`plW/P&wbUg#m /i q=1VlUVP2Wf\ oCc6*lUٱUٱWck]* lUJ*k=WZa7rhe!~ѹ=y[5"(QPc0Zv\Vr+Xl ˮ vl 6*lU٩LUX)lcA®9Wp+Q8qW[ o4*8Ҙq,UxlKWr1lir`[usW+WW/1WWqVfȫx0y\qKJ\uq$vlUٱWf]vlUٱWf]劻(pT>9~[ejW:0u1B#)^=QirƧ hy\I7?"U?PoU| M(Q= RHe8V*#b#SBH7U#UWTݲCjr\iCJ5a9|^TgѺ)—Zbo o*w9`W $8S ͊- Uو]\dcS 2[^u3b8Uf9U,b^(X+$lUثb͊]vlUٱWf(n}r9T!e Wfo[^vX8Ukf8rckrQ. C+G%qULi-%ZS;"MⅧ+ ]V^_M3SojӦ*\GVr8W V riVW.Deb6o]p*\iUet]蹩L[,b86* 2+呁Ucix\튮1R j>PD _ח NZ+hp++XUn^(j7Uc81TLgUFjbUZ9clPfZ\sm(\?`?g4]i5g1fSЎ_~yg*QՕ?MG>8XQ [1 pO~ɮEgվcq*iދu&b:cb? zz## |L3_\K Y7XH Չ间3k㊻d Œ1We`8bgx8la4r/s]IF(v4"S]eWfp:*z!qWf T=Wb`^ O\U5]bRj#®nTlUٽCCv,be1Wbj)ORJ5-)v+&Q.ʯ#\ ecƞ# Bsu$C. FUث Uٗv_Nq#0 cr8ENv2T1)v&1( M 58UUM.T(lQhI'38Rs U`VS9qZL lUثb®ӊ\22*㗉Uf=)D7JP XA_ַR)k-#ȡ.>=E,Z4'9&mnqV}GO$Z8d ?Koţq ?R ۃ dV1ihYHJr>4:coMlP,W巆*|1*YGح#tr V:^ '8mſ#v͈.{Myx .۾*|*jUv.) Q+?늻)C튻,:q*LUdmC]daWe58긫b(`WbO~,UPGg]UHAN*QFإؙe;t]V늻.l{]R9ԝ*1s'(Nybebccvf;ݩE1C>;.*zWcdM>S, vYc^(O\*쨶o.` 6q0E7]8yPUc|_aWb}AĚ2v*>Uؒ` ]ɱCϾ**T=\Sl8- ) c>:Uy6iO_VU,2L`U-Uj V\UpG L⭁2*9.+kU0DeV\Ui*2 6**lUUٱV[jblUq#6* fZclUr%usaWVt7UlUªG6*4Uel1Ku˦;dR5qUJe(S9J2WS,`)_ֹe *RDʮ(o늭-Lpf$]#6*Z6u2qWqC*¹X-WX=*™gjTWlUp0]f*J- ]]jS"B(_4jbFA<2$C}e[jrI͔ \ީϭ/r Meˑv8=1Wb`yUٚN{®fT vS{`We Uɐ R2B@\Rj-t]tqWcy,]$[r\Uؚ!늻Pv(Ap+ث5j6v8|'늻BvvQ8Se . lU׏q˖@a,X1CEB9'3AۙV>8؍U]!*s8@1N(vXjbX\UeS})vTƄm]ێqWfVo 99/LUأI788Dz*އI 2:bc~a bƬɥ1Wc| Uȡϴj|. ;Hay6% + ,`Wee8b͊6*ثb8 Uxb]6*챊0́.PإٱWf]vV*ثC*.LUXRثثbf]6*UٱWf]vl ثWf]vlUٱWf]vjaW U W,䕥^*6*^E b͊6*ثg6*«rb®͊50+\* ZȔ;{.A|/zŸq9L MJѯ k`RPRmqC U50إن%]C]0+yXһ6* ]\Up%3^)@(7Z4Wcm4V^1WzyLRuw# &Ɯn.\ lcI)\\ 1ԨȐolB[|dx9G!KyDbH:T*9Jn8-]e*' i\6U0+y)vV*ثb͊6*ثb͊6*ثb1WeP>*øVKLUNxACyN]N7*SYc]97׬hPOb@?iǒu-!xEႺQI #|hU8'S`wOy!jV8 P4:lr!R>AݻRkݲ SޮQ|m( H2TUQWZCt͊]qU˗W i0 rPZrT͊*3 *p83b͊V\jUp\إsbqWV.+Vh[p9Xva/-;eSUXQXT,Uq+f[嚘PXb&6Rι\ZUUZ`JD⫂+TSن88sShU-aU3baKLUp]LU2WWLb1LU`.֓|…L2\]ϖbp%Z5ƓhW Ql WDP[gYdJIQLgV%-]|1/jyIUf;% I͊\W&jb鉜UXTXg6*q9chhebU0!c?*NV*Ƹؤ+-_ D&I(xzhLLT@d 8k7 \jTUq>ώ)i#"Gl[,vNl0^oE@o2Y0oZlqWf*)v$mS|Uأ WbڄP@ƫv2B%W]1bjbĥ®v |U5_ U𼖝0+wR~P\5*EeUR(*Nw1KSJQ0!`X튻ٛU\]f8qwn]S;/}a( UR¢]y*m.P=CEqWc޵]+v$G]j:t튻>1WeJA'@6+3rK\/ ®Ő_Sv: u?h :/*uEzeCqqq]śs]J]x;G*2NŐ~+CRM:*qsM$0I+/ӑ̭ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6%]0+C 6)vV(v^*ثb8 Ux*UGvV*챊0]0͊]vlUٱWeb͊6(vc]vlUXRثثbf] ]vlUٰ+aWf]]XUثlUثb͊,`WeW [͉KAVUjr};/FPϏͳ,s{v V+]B>U"1AoH80ł CȚPN7 wVjb=\϶S`HT|a(%qb,2aO{U +y*㖸xQ`UF ]L sblUٱWf[9Vƶ[W5rT򫊻.9`V-h* JBGg8$/$> YɁ{_!!^Q@ɰLebf.Go5i0l*^k66)vlUَ]®+y!َvlU&[Ct08ҷf ["2UJҹ60oQ xV\q9e FUoN˜EA`cn1JqWcI)]Q[ӁW nM6(he Ui[']U7a1U$(͊6*ثb͊6*ثb͊6*ثbK3b0q$Fh|G\Vh/|1%Iv8]ygN{gA\!)-v8'TcUiq vjlZ(TtIqK5[k 땐^_l%)q m[ODy@ zdJR Z2`8j*;㩒U7%v8>8MȾ^ȥ6q7l \jbl*)*͊] r*N5L*®͊F^#6(ZF^*,#0«NV)^6EUTf'`qVPUi[6_¹VWXcl*lUfk W!F!ƃV W*o\UqLqUW" Je \J18x8Ӿ*51WW51W1UqتI[\U3ZY[lU1k2\lUe⫅3 UwƔxCb X1͊L*GUk*F\UFVVLR8 qeB&Tu};jӧH`lڞwWW8XÛ sbf#\6WCa.4⪋9VWbf8C6*1WUa nqت9G\8"=rWlWJ8tCA7nH+ RG5i[x ijU!s<LUMT M~Ѯ*[:I+>ڂ-*,$*UI@ÉH'5cb\2$H9.9U9$e#1WbdT8 ]ECSvkr/ rT]D\]7v_URّGb;biMyt8@p6*b̒o Uؘg\Ur~)v*ǗqCސ)]$m]@Wb~;8vn!l*r?ۊ^ C]u$SLU)1Wb.y>RQV(vXZ}8N?bbvaTN*zA@I>aAS\U`>"6]rTl*85]jHh{ʒ Wey6KyXU ءٱWf]qWebb1We͊6*ثb͊6*ثb͊6*ثb͊6*UxWf*ٱWeWf]vlUٰb͊6*ٱWf]\UXbyvlUٱWf]vl+Nu3WjDP҅o$(]JQt4DDT+lÕGQ @{킁QMg!t׶JYyPJ::ft*TYjV: k`HT8R2 c9&)]ƶ G\(o*LU9 _.,`UPk\ث[vlU[lUٱWrlUQ%`*ث+Z7#s)8$RGM4>淭y^ߧ h~(ܱW إ*®FUٰYck/ 6)vlU}1*vlUyQf–W\R#,K spҘmZ',tCͱ9\0Z_7 UY|@ #|fW#V阸8U1<0%xƶ`dS^k;o(Cc3bqbSb1leP RqCpYTWe)vQPR*Uٰ+b͊6*ثb͊6*ثb͊vlUٱK|ڍžH=Պ NhJZT$5?XEucIqнjZD9) ],r/2 _١Jc"c&2˺W*緪L:x D~c"JxIA:SlpAۮf"U[QƓ]遒$׿^<ث;=v®4헁[+qV51V(Z'6:-Pu[-S6(hZ#.i\B\qUsS 50%xqU^Y*^* ت.^*Ҝ⪇.ҹcZFlUa6*\l&bqUD\mqJ  L0*5*qu­SN*eaU0Up8i+ճR)W 3Li[2W/lsWsͶWQ+|mqT\ƒc,',+olUk\Uc ZXώa)1,eS]޹tlvQW)U+Mp%[Xv®XպwLeUYMrWW:y'_x馽桂\1a2V^0bP`b-fZ9Vb\UYӁU UA–͊8Uk6*bX(ZNXRsaJ90E M+'= !1iM5]!Qvrp1KVM?qJ´<|1cpSOqJMg MA=߉Sž>RՊrH"R .`\*q,73]%+^7L vT!6(v=Rؚv5v4#t\%]H()_|z+v+!`x U،U(cC]t#tƐaWcM v5p*y<Ƕ*ޫON%YA®(ґŨ1Wf|$qWc]\"v[1Wbaoذ4#zaKuȀS*aw`~#4yv8USa(v9EM|qKLUr~c P6 "vT4]ġ5;Uҵp(vXJY;2/ ] <1C1bD{ ]F _BbUؘ}NءNثaA]#3R㏹xnG!+_#Y+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6Ky+bf]vQ]/v^*ثb͊6*ث`Wf®͊6*ثb͊(͊6*ثSv^*LUٶ]lUxb͊6*ثb]6*ث*Uٰ+U+ +vlR͊6vlUٱWS6u3R49j4-C_}(;mɦbom6_\A#1&&#uepi`|h>MNuZN؜QncXeAؙGZb66 S0 Luk^R6)\Nc $.]ªvGjLUzi5)mL_˦*ʦ*ثb͊\ت\NXVl*rIisSo51VSur銻VITTVN7Wȧ9qGH^bkox`lV'u3lp+)]\S vlY;/͊+fl vV*0)vlq1 Pءv>Z;1dZ'+ *1zbMwP oS\W8Uu3n0%Lk&ČUp\o3 1`WcNإp+y"SbqCyDW2`Cc7 *q1C.ʠ[ aK  +]vlUٱWf]vlUٱWf]vlUن*ثb͊+h׶_n뛮ت4Ƶ+gq_qK@ mϖ˖-.ǩhqDmP7^@.TBb@&0 "ߠדa|Cq5iy1(A X_DžŤbLd  d/12*.LtUQ}\[;fU*^نU6*׶_NҷB:4j UmryXlUf-f*,Ua\p f«J UlUu+bHdxٺq)P*jeUaVfZ3brqUbeq]Z\*2We6*rqV5*S5*|UY.lءtqJ+׮(8X[XtZaSs&A،ULNU1BrVrj\ ^jUꙈ*˶4 wLUa V0* u4[X0⪫b+]^Jqm5yMO铊$;pE/dbPv"0"CS/\ءRk.#S4bq)1UUv*k6)k6(vXICMU9G$*;S""\VF\2!WM4f,:eVpxeҫ0s=.Rvu…9TW(-Nժ2L俘בvlVqo%<6AK;mA?e" Sl(v[n7ġT ]\PKL  6*l`F ~JaWc%NژJ)SD)cڢZ,*M{`Wcr#|U|C"|RkDj ф}.4*E1WeH>%8 ɶ]i@F;4|،q\U•OWfGn)]e_1We`w;$ v1 ®Gзኻ-"Vv;UO=G|*Qȼz"#z֘6][*P|w]0Iv'>v6]jZcRY PT(]9Z|(v*׮(vgt1Hv3LULþ*e6.ʍhjw>*G r5b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbML/~-dV!ٱWf]6(vlUٱWf]vQ]b]vlUٱWf]vUqWf*ث Uٰ+Wf‡f.\UU].bf͊6vl UٱWfٱWeb]vlUٱWeU+ qKlPlRxXPإGvlUcvb1WeS 04aWR+\ ~!(yte][j3R9%x,` x^%-ֿ!13MK¼JNQƴQ,uY \Q(EM:~QzR4\IW_&AS`=TRyׂ;Ni1@Wjbs,bR[ژd ͒UY@ۮ58 Ud\w\ Қ Wr\U危Ve[\i Ͷ*mfjU­ˮ Vf*s[7$jW5qWW/x#l=DT^75qA[~F>'+O00|4w es$J)BÎ5qC— f.ͅ.UXxqlXN4e6ojb1Wé*iņI-cK Up)u1J\Ur2U\S5qK*16jUxƙ+w.ƪ⭌7+SvQnDaWWo/"ʦusSWp+x1KxÅ[V]vU1Wf*쳊+ 6*b]]b͊6*ثb͊6*ثb͊5qWf':[0u+b?V5iCaouH(? -٨BvY8@JʺdG"ś&)u^"+IQ朑XyPzL Ƨ_^%ЅPkOk4?&:j?u.#?Po& ߗV#?寛ld dxo?/ R}"/ Fo"`r&%6\ww-L ېp-D` sն0Zd^heW\X#hn*6jbh.X8\ULaMV(^,bnsb.lR15(W FYTrf]m V*6\W=VS|Fw*U+o,aUkV6*<qJ|W]7U51VS*zD9%*wʦlɗ]U2a mlUoLTJf(pjUz0P6XȕT\ E^ت9tV\⪂<]WU uF'E3`OI1o!%]RW6*[lU ƑW/\0YFVVʦ* 0UEdPULaT;8RƖa1&5>9&.%caxSN܊QU1qT+J1-j0*&Mb$'S%1^Cz<|2Q9D`<lHsnNK1NCJ(@6=佰0qǕh<0Z[Tbc*$M+:>ءr3*v= )vSר®5PI]C"ִhȡR]+v$nv*[ )]4#lm.5؂7bDžָJN8%P*REeB늻(QߩUǮ*eQLUؔ [ثES,rQPpf銻O\U!Uٙ>(v$XG׮)v;# Wcmv5S41WbA' $ኻC5OJb"I]ēq튻.5!%_}!8֘U9F)Eī@O@а؀bvX\i]Ha\+B;WvhɭSq˻@,.~I ȾV~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y7 lPlUٱWf]]|UٱWef]6*va/vlUٱWf]vU1Wf*UXbaWf]*b͊+ 6vl*ث ثWf͊+vlU+ qKlPlR챁]6(vlR죊6*͊G5qWf]MC\>{0Va5SӶUk)ÿ/jP~\ lM$^h~tof΁ir $3Q+yeHb^%O~8eEnۦP*W/\ت Jv*zbW&#FJ >99#5+c_5w!.*@SN6RS5\b囎*YtWUuq`#ur]\]\]\إ\Z&Q<.J;g* n]Y̱ɋtƟPaGVcŬp!Y +Xb5.͊6*إٰ+Yep!m(o1RaV]2 l ͅŹ[8KQdbuʦ(nRrw-6S ePK{ep&TҸyb"#]LnW+usq[jb뗁i*\R4vQ]vV/ ]6*ءٰ%ٰ*ثb͊6*ثb͊6*ثb͊ٱll)Ⅱi0?qd߮+ s䄔 ë]InEfK&0I>hJkCQIi|`v;`Qù#Pe؊qsoG'd&T`_5>0 $?-m^j|[o 8^*}Vqb^LլV K)#4Zu$b$ 6P)X+ˮ([\Sw3ojbW͊ڹ KebE'5qW0'6*͊WƜUP /XFjbVثYWf[50*G^LU\)wLUze f­1LZ*f*t[啊lUqJ|3dJ)͊'/V4-ZU"ep!Ƈ|di9Vk9xvC46)T2JXȥT f늴08U8ÁQWW**`1qU&;PT/I?ǒ ܔ-JBkǔ} fĩr]\ثurW2•E8 3P`US\(JsbZNa'\V1\T[sS )\kUğ"ZrJqN"T)ld SvJ/FX(T! !F֨a06*3f-aF̌ 2WW lO_9ٗn389 xa,[D]:]8\Kvjv[vy7Vb͊6*ثb͊6*죊+vlUٱWeUxb͊6*ٰb͊6*ثb͊6*ءٱd0C`Wf]6*(vlUٱWf.]6*RP챊f'p+o(b͊6*ث`VlUثG/8*ثCG*j@[#qK<ʱ10oh!HzO*f bUUAA+́ |Nؠɱ)=o\Ү É(=b8 e`J́WL*jb3Susb| ]6ܳm5)l6j PsPbjbQ]\aVfZvř;i$=Ye! FQLQ|,^e%oʊ>ቩªfӎĻ+sb#3t4dV*٫]b͊f,qVb U/Yo(ilWfJ쬘KYT8PP_WA2*,F@X)o0 ^2,­VRq}*r\oPWWF*a51Wci["8x1baA+`l6ƕi0EqVU1VUXPإ٩6(vX]vjbLU٨0%T‡f WeS]vlUنSvl*ث`Wf]v8JCkze50R# 7kH?i/ L,%O!%jIC-HĽq+Rt8UWLY?Qz&}86˳?1ï\@iZw+mQK{b~1}LLi4S t?Ip]wȲ)i~G|pgXW5pmNjrLUSw,RrLęf*rXU_*P>c[-bHX qU, Uَ*ثb8#_ʙ0+tEl*Er(XvUrǾ\b)-l53S*+_1^jb2e«KlU6p9V%pUcXU2"ɗKleaUI\ 'WAg51VYVRb0BGW nGÓ̀i$̳&z1Ve w*st`qꮅCI9{C/e®~늻.qWe> vT>lU\;.v09+R1C&ZK9 ƐF劻(UP]n`j:aKPu$;āqVKD\` p%؝Z5]<rb~UمߧlUp-_]b䎘 ւEPM N)v( ,fcaWe0Kܹ1KVPӮ(v5`WeHx. PWc^9u3Gw]RvR0|]ʾb]+Sc]v48@]~P\ $6]]'v'$(c8x?Ю~QĆ9د͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y7%2VWf]vlUٱWf]\UٱWf*ثSva/vlUٱWebfvlUxٱWeb]vlUٱWf](WefLUxU͊XPlUٱKb͊vlR죊]ٱWeb *Pʦ*ثb®́[CyWe1U*kUفZҸGlU#oa'Es#s1tZW/ENCbI's r*ls.SICXZ F(BX̃J2FrLUNc[=3bs0=2!o®͊\ebKeVebLTƕc54һ1w1kʨJJє>b{biܤ#|׵+zd0\$̶%R28N]*  Piѕ[8!Z+Y]ebfC)p]\U\UxpR}rƕiK`U-W0 ]-rCƜ \NIWq8)[ 2N42׮ W1!mrleRo lZ⭃WW7 JU܆6xӊL#]\ S\U8P0 q`Vpٰ!LUUXUٰ+b͊6vX]Uن*sPָ|pU㊺EqKyLPث*RٱWf®] *c]ʸ b LS-Ű?낮nXHy7%3 Uثb͊6*ث*Ucv^*RPXUٱKC+vX͊6*ثb͊6*UٱWf]vl UٱUWfWf].͊6*vlUٱWebͅ\2V p­͊6*죊6vlU͊6*qWf#va Uǃl+-e"x*IOʹh -ܜo+ $i,w9CJȔ(W+$8$UCYHB_C<1VkkIfjG`E`s@wphw>"27C$ b=1"-DٶXR3. UsI«L⮮4UbWzxLpަnS51Wz])8O'R.nF l%hKNQ35:u^p (^M! -|x=kOkdշSĊzT5\gZVH?<(H+-M+2YȣFǮKv i&p=\jrC] -f]/ 51WfqKSvjWvQc(b8SX87˦vV)vc[-[nqUebS5pyt*L(k(PƜWeWo6*UT똌RRWUp8 bc@.jbqV4 rWW(Uv7*67[b8n*0L jbLUdaVurYtSus RVe*0儮 WWb88(qKUr/|hQv8i8\UPbVbx ^@0OiZi"OUJ-e{wKy =ݿ1\&fP- xq1xY }рG ɵaArjځSԒ^,(OSFTo oUx6P0]…Z+pÕ]1VWF^+^6q9xrk18Cb͊eUpx6hb0eS 嚘kp9KyGlfqgpʦ(]\UsbUsbmc(U9%3b]W.+Wpڶb1U9r)\6EW͊GTVW\U)EkVc$)#$+[+TWè O[u_Uxӧ(.I+)aUX+WpRz`V\%lWcjڙa*,GZ7һ+GS-[R5jW)˪{Mڪ N!888JR/DM Bjvq9#U_OU㈀-cT^͊`BlUxjw[e %5&Dz핖H_"Pj^͏8X*з1i \|ޕuKv1|x-fE4!F)v&M>(v4ٕjwMWf *c1WcLUَ*UU]Xbv a]v^WfQ`CƟF4jvdJ(vY^'vlUdbK0wnnGq@6ڧ /}WfEgn]Weʬ!.]##v\qJ. SCI®w]qC늻(qK9s]9U]*6]脌*b=+‚SF[veW4vY|qWc0a I9$ "`Nv8t]zb֛J]IaC6R!aK_ Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɾX3 PlUٱWf]vlUGvjb1We.8/;6*UٰXv^(vlRءٱWf]vlUٰbLU٩50+U]\aKYX`VusblPbb͊vl*ث+Vn+ jK\UX6n+lPV*U٩(↫1Hq˦)jc w劵LtOGS1V{:KdC5V7?6ʛn[1U UEs,|8Bu 5O_ŦeETTC!\O iq' h~h~n~?.U(7 /3yj*^~N2ggCvDj9mehlӾ୻Y 1S®DJ+ WNL.UL]1WsqWs qWsz1J`Ef1WTR6U?*e@k>~:g4wYڑ>#<+(Ij ӿ˗LÔE[a{o ' P;{)f;;qRPFoMy9M{"0PG(o.L!V/G9 @6)wd _/4ȥcֹӮ(SǾ]1WXB\%j*eWueUٰW.jbF*8clUN(lf]Lc6)l إ22[G|)o*ˡ\XcU0!zb))o(PZ]1WTf]qJqV)vf[\Rƕ*rb+\m0+uLUDb*pȱurxXC1L*q+*`b͊50@aK;pR1WcָQ-qӮɺW"*3I­Jb4rS$iǩšq*X1!i¹F+KR킢Wdڛ/~b)ڴl*]:{Pq eo|Uu^]}gMe&AqȮg w8+}U튵;LWLdUps# W9XUˮ)Js`U~Rlp[jbo+^3b6*X]kLUʦo.L*f[6l8=so[乷Zj[́[G`W6u^*(͊fZlUٱVV*\pp8ӁW sttpڻl%PLث3S"٩(Utf[d=r(gf~TFi[qakx.ԙcO\z'kU? FR_oA"+j?Y 21w_+n73vF=c~r6Sk ucr:'pnpELG'eqR5~7H\%8ҭh+[ƕz*(H ;->*SZj4W1@[pzo~  J6I4!|/4 ɔ蚀1;I F\mN*TQ p!kӰǞN@S6zeU0a$L(èƑ*\Oi0Zd?<v/5Nl1|wJ_RFE˃Bv2- %_v= 촌W 15]aCnUE]u]eBx|Rq!qWer.ƒ\Uل@Cv^®O(v8קlUQ1%=0%e,f' ]Ըr*ʅiLUXWb6Ć!خu$ƈ v8W 2_]FثիMqC]QLU~RD:ԮE]`QqWb21\)v- 0fО ]‡%JX64\*ƫPt]G K8*]q v*Pv4K;1Vj6\r Ćr1b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8$(^ɶZ3bCb͊6*ثb͊6*ثb͊6*ثb8bxxثWfvj͊/vlUٱUWf' ]—f]o+ [͊6;6*UٱWeRU6(o7|Uٰ+U]1(bjbW*͊\ aVb8ULR]1WW-1Zst.U>.`fr_|$p1 hH9clcSH*3d]HCHr#;sIXL? Xo&F9kT2f`=F[ZzmO b*BޯNE?ʿQFl#̿Iŧ'Ll]-wG_r(`ӧqwڤ^tcxj./~UG_^?_(oKǬcWᑵkO?7?1w!?0ώX|?7㊵/?2G*aoic_+~Q\uڪGi>~1˦HzcjԞjMݏTLVF$͖~98LOZZ]G+$OD 2&rI, 6*rA_ȥNHoS~ tSԄ*;W*ͤbaV"nzm{JCק<1_N-JIod14zf6ک}3Vz .wDwP*׸= P?V#_2v$ZsN|RM_ ͬV;K텯o"5o|@`B 2)^7Q;%AZ#,V+^(k(f\3b]vQ.͊.­eReSM+犸Ԯ(n⮮`)uq0Z-Z~WW( WW7m[0]۫0+c7U`1KYt]#\LU1Ku\8R*J⫫\0`H[4p8§Q\Ur\RӫZvQ50+x[n+`Wf;1銻0]ҘAWf51CEibR S1qV]\r-pqB&8ޛ'sX«KaZiU j0dQSͬ!$´ },<B~{ =Uw\Xw<鹲{$B2L wf LR _* .UrYWf«xثCC1«ebf®6*hfW+f]6*lPl*sbf]\ث\ثDf\5p+df\2[+lU[xo3Sw,[/5\LUTW\تfẂ 8+ FX '3 bڸUަV]1喹`JƝJ fZڸ@ű|\@\z#-Y$^9'3́xy?UI cYP_#]5N*eTqo*,P i-ʮ(_18|srWxpVA|FcJ|~~] ͨǿ/Adl-"%f 1D UpZ劶bS1Uq+W,ruƶ@n7 GH~yŊ6-qI[rh埙&Yӊ]*1CfP+ LPJqWfoUؖ8 C)v$oL Qr(v&?cv6F!ؠWf(zWc$ *ӊJ;0QJaKZbeĺm.dž zWfo|)vf1Wc)]31C@'Hl!,$;]Gb8zD} &U=K˕[)v(˓ 5h`Uٝ!قRܟ!䂰r3b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbML/~-dVW5qWf*]Wvj\U٫5qWf*]C*®LUٰ+WeaK!ٱWf] 6*٩/vlUtV*졅.͋f]vl vlUXRsb^7\RPثb͊(**r[lRW6(nWW1.lP***q V1WW-v#u9 gE%Pw.afrqy-#!VfnwV䠟UqRe(med;匚r)=lH.A?ĝl.9{XTep9zc)zl)޽0C\C ܊.beo?9,U.QL\Nj) Hdž8AҘqU@{e T xs LC/8/p*Lf'li>8i-d}s+n*pneFUT Zk VgT5Z׸\[@y Z: PC!yaFN ?F5:c G=*Hiv׾휱ⱒ6̋*>q~0D1Wi?NSP˜ɠWVƒ@ U|!PژZڽPy`\ҪnK90yV'n*櫘ƲH݇Zޘ ;^lz%(7 AD5ԴHnZ3cbbg*x\"4Ǵ5&q5Ds+*f\v0G/aC RlUxPe6) ˊ?Ӆ+V*콱Wf*1WW*.lU͊\ثxWovQ]c08S ]bQ8f 4 Q87UAT+8F*8Ҹ`i4(liUJn1MVl# [2[FEQ, ]\' หFECF0ni N< U Z'(NJciL c0Һ!i+Mb?2AJOL褂&]ʚjEŨza[oG9\V i*t,I(@`y9n0TQ9;H9apHueU#i PLAf9ݓn72ՍH u=Us`JU]lUoFV*L*Y]p!iV(b)]6*3bf[mWt͊6ثYٱVnVfZ rd⭃UbٱWf[U(WQ1X W178UUFcUƯ\*1BLb4ʦ)3)3eҘUcu1®8+dWa'iZ"qeH\mqJ(QS0B%ָ B ɊG=IJS+l;`]EKR7aOF& BX*S\*\ 6*9X$V<զ*\xi+e -]UV*y`UUl $"mIGv Inv됏6Hk]NHS2¬`)LUuʮ*6W\Up'^́Z$f'Xyc RD6()Gۚc+L82TBFw̴]=Yj;̛/VM.wi.6?ˋҮ+g'D+=V؜Uؖ =*r%—e ۡWcTe[*4]']2m@We|GzWc®ƆvQ^< v c*UTv;s5],F*lGl v"uR‡br)2*R玻*A&(J"8L}qWe]3PrFǨ1We:R[5v|Uأ=1Wb)/lỤz>aK#t]6WbvǨNvQҨw."0N*{UE9r1K9]b#] `Cv=qWc ^TqʹԮkґĆ' V~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6Y lUUٱWf]vlUٱWf]vlUٱWf]vlUc/;6*ثb͊6vlR ];6*xb͊/[vVvlUٰ+bͅ]vl ثy)o*ٰٱWff] +vjbLU51VLULR]\t W51WW*LU*r銺c8V Q䛾2lK ӹ> Au9C$eIAȲV \Uk *lG& 7\!(uw"Xo/Oj9%ڔ3,8R<8;o\5aL*\Bj 30ż[.aߍ?OdY68OLƕ1{kL9 Ĩmj:*:+T4llUZԄ eR:d -> BeXش dEjZytJl8|s)v%04 :U٣zv(FWe m\ *ClRLyLUا Pivv4l]I!;a*`GC]("*d<| vU#+C PbbTqKi Wf4—c &qWb&UPqWbbʊ1WbAaC'@K }7!]PKdz=E)*hJ*0+|*;Fw%`\ LqjqWeېE늻-̕bfP<1WcNؔqaN *wPoKׅ9`WN0ڑĆ%aKo+b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6Y lUUٱWf]vlUٱWf]vlUٱWf]vlUc/;6*ث]W ӳ Ux)v^(vlUٰ%٫/5\ثvV51C`Wf] ];6;6*إ68Uʦ*7S 6* v^vlPUٱK銵\˦(ur51WW51WW51WW51Wf]\ثYcp cҁyn,VފtwP|@|Qy V]݊S+d3SQ+ra !2HAˎU rHѸhsEvBfly8sye?aPɂtpi1 PsO7o็|6x?S(f36…6SqU&x,bFX+},raB '\ 9\%rیت<0nP-C6bmvДae@@X;}Y!;Unb+avJ+[@%il+WdF75?f2I2U]}S]aJm@l9Ђ7wԴ&vZCXjY 9=CةS31٬or%U:14=1U­51U50*F)nT[͊]L XXYLiʦ)Z7L*͊͊6*U͊VnVWs rS(U®LU6*bVuXȔPs`UAp*ˮ)hثaFlP'.b:f'TƓUU2l L*(!+aLe2ETm gapMu u*+~ EL"JG\az*;r|1Dq,+-d18iYFI aCSwʑؽFl)LUciVZX2uOF˂L:Nlr+0Ī~Э~eqB ],},qWzy5qWp\UxWUFlG W,UEJDUqUU*9Cxr2 +c8'!ЊJʗ "17C IYDr{.F8PZbq9xw;r*)DF16)ÍUsBHNwd/'ܘ)8^KO U= ccbː¡ؑ.%rM+Up)⮮1y`KT5Q^ءK®'%RǿL)v=84̀kvXmlUJ|RMY$=qWb7&lqCB ǰX쨃7]lUM v5 R 9b̎J]u~Cl vP6];4]KSNP4]7;WcL{WeAc1$lqWfa*X8# ]q==Wb6+M* ;]Cav_ʦ nFEydRj- L uOQHby oNFr+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6 lU*ثb͊6*ثb͊6*ثb͊6*챁]vlUG ]//;+v^*ثSv^*ثYVWf]bfŋK銻(WeUٰ+b͊+;66*ثu͊WW1LRjb͊`b*r]\Pb]1WW*F)usS:T]\b]1WW>S&QR!,N94{tc?P ܘkp[#$'K4RP+JSf*X! .>- }nL}r16woҭE!yQO/My;ٛ_0nbEFpF +SFd-l.響Ī͸=)Sb@`A7ZE*]f.;Cj!!U٩*6*ثl VWeW \1UI+ [ˡ CU㊵\aVW0]\p!kW8`drWeb⭁⭁qV雖*eW8 ܱV镊5F*4Rጦ*b1W JW V®U٩.L ث*1WciC \Us«yc8)]lUEpocf2 7lW +! FجD!FF+()JZ$ 3wW•8G m):'d󯚢]JjqAվ%SI&F(uG|2KD}rs5/Ql E A^v7 /lW6*NVjb嚘l)lS6olث2 x2늵,aB+k6*إxٱWf]WW51WW51WW6*8U‡f]\͊]qV͊QaWf[T] ,`W إءX3`UG*`UD\ f dV0\.8.(RyqT^l,\kUZiO]J.4P|Qb 1Kfg;eM+`g|Zn1~ Jpm] KG*g+SCcz bJzv®;UUٚ]K&ƣ P*} T`WeqlU`1WbnS_aWeՎv8pL']+qWe*kE4qWcaFA\Uٝy Uq~<vIrBKW*Bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y69c$͊UٱWeb]b]vlUٱWf]vlU`\ Pث.LU٩](vlUٱWfZjb`1CKYWevlRvlPb͊1®́]6*ثbf]vlUٱWf]vlUeaWS50%bͅ]Z]LPLUR[V*#:Db`1KD@ :Ox|^9"bԜ45ab۸1cIn&̻bWj Cɶ96! 0aC [IY$WC$̶z܎u.+*[QZᅭCCHK/o)qҙ:Q3!5yw)Z kNS)dLj­ͅ[ᚸW,Ux« i|UUmUE9EUU9M&*l Jv^zhw,aK2^dZXO~% Tn]my}=ĉBþ1r`f&Kzv ykyeҠ:gM(C1$T"21iBM)`!tX*T(Tإnf'e_fjt2=%Ml=*4k#HD ]LM:%6ZY1BMsOՌfqZ S.ԣSJ(, گT1ƳPtƒE jt u!@RۚSeBk3@%59S+7&;3K6ٺ"B6Z~([* Rjw<[G,^QO( X-)|zE GƋJmq(g&⻅ӗZg]B@rO 7,W#uj%>Nz "=>an4eE##)ǪR̜ 8Ft8\qmQ!01E}fH^L?`3"9#!`cJ\>ȏ/S&(UH W)}[ccJ6r!XdJ2+ PR]\\2UX]\3m[+qV)Li]0PlbW(*참--eSQ\RW U4)i\Vr\q[l64l0p( Xb50S7\4aW\ DReW"(vU0 * vj`Wf*R↫F4cC 2Bc0zaS=cƼL7 G( uc8N&QLB-HqFN;BȤS QQBk"B+\ij:Ƶ<f_QYDS)R*B奂ipӷe2ܦSys_C^U%G8ׯLѧAU})UqKc,`CEˮ*14ƕA|Ukez9W+i_Ι[\^Ɩ3w$jvvKWkwͅT}byt0Z` ;fvbi\,ilحA3W+mLs`V0$;f%]WS6*jaK} 2!u)++_WW17VqWe i/\cj.6\6)U(mn* Ubq^[l5Ҭ/N$RdrL(R&tB똀2DN5ZG@64#l.$+޵bUd3"V$qb) llc=0ZQ6vn3+&:z ` Q "aIQ-I]-ai=ݪҐ#idy6=2Ġl*^vQ.®xGvVvlRثb͊6*ثb͊,`Wef®͊6)vj`(v^*ثbfZ͊vl)v]1Wf6)vlPثb͊6*ثb͊6vlUٰ+XvlPثaVSh`WW51Vt]\blUsb͊.\1WW51WW51WW51W;%RBA_'l`_^iP]*˹%o1nŶF6E!_51URsaUW$4\ j`wk(/JaVSAm Qҵ8&8(B9T^|F) xDڊF()snx34\Ur*QlUzN0*K⨄ƗQ)e1M+W<cZT':#ɀiYu"uȷ.CLPAgߕZgr>'ȡ9qbκwll0׭rA.+[_MjyB0xIʥ l:Kq}wf$f$X[u,5@"LzQ__% ;BfjG*!s[Ki_ƽb&kƹ?WeIc!n91-^[(كL@"M >|-y,vq E]w$fG!O Iܙ\{H}#PH8'YBrޠƆ؍ۣB  G!`]?4OKR^X*c=Nl11xֺS?2)ÞR4  u= dZMD -70A.SV8_wK>d$f- nXW0r>Dr -DB׼M81 D 32$k2j䴢oRrNL#S@c4$F̈匑Kt~z!T ],y"1X(V.9#ǽicq)"hO֙+ _Ubv.h6<^\1>"Nj婐,/{F8c,:~>jb/SMƬٙ?Ƒ"iʲW`>4V:& BAʵ̈⍢6J#+SM|@Ï7Byj ZD p07*иJo7d /.XgN"KRBxXjylvĥxOVƘDĹ1SyU'2hY$A0'(xfTn6c 9"5eeA4,69N,hU 6Ė̼~[$rnMxvvt8^-Cl:2I'Fnz?Vbx l+1AHB[H܆! inz~8KyyU|3 Sm8Oa0$~# ;ZN эNF SJ*(uP(I>b3JuEr' l+tGR-[^y '@dP$APA+$p)O1A`58yWj}QNeHn }>Df劷eJK+*K(rÍ/ rbܱBUqJG*bW ⫄t͊*+ORr*y2J(i LloI.3p+m)֤`w48 ŤE _Xrc=) [ja%%l?#l FBr)^1븦(jІ?1 M?2jyYAd 9~l|$Iq@xF(le"TmTإآqVQt.i(x.Wcv'Fv(b+7*UL=A_ UUqWbj`Wbjz⮮`@5]\7 ,.Wur 0M%٪E{fy6%3b8RUc/;(eaWf]vlUٱWf]vlUٱWe PUٱWf.͊lUZ]SvlUxb͊];6*ثb͊6*ثLU—W/us`VWf*r*b͊*Z9WfZ]1KU͊WثYxS.UوjaVSE0MKYEbzgB5/*~!S7FO#nt~p(nI6تqXXPeQCУ%-HN!R:CV=}2;yoSkȅzӾQ]H!1F__k$B@@-X$Y3yOY0e%hYUX 0exʟ| #^@_(Zڲ4|2. ]̷nU-5)QaV)Ex V<\ehnAL~l!fКfhb),beW ثDlUU0Ɯ*=1KV^o+ ٰ!U3r雖ө;Q|U2®,1UNQĥ4E[*cIW [F(vV\inU)2Vo18qWf]Z9`VlU٩ R\0oU̽2A-0A)X,!Ɏ6hw(w† ,.ت∃'RC~]dծVzîC.AYd7c>t4Z#->qӧvkxcX~OLl3ǩxѤہZWM'FPfm& w @\nE6qX.*3S3k@'(><݉ OImJعk%)iؒY>syQOcQF不zV[ Cd$ssVcdCHJ\R5`V]*_S\Df0Lֱϴ1FCJ4^T@}2R;*33lNSF }UNH؊f,FC(,qP}镙#gl$5,౎5WߙXcrZƮ֚Յf؀ޫqQ}'ᅄRQsm5Uӄ׺ԅFĩ4̘ l^,*aQJדSrAE0HV dXH>־QrolZՄsTzY\*ߥoSʮ*؋6*Eby6%3b]]vX]qKb͊6*ثb͊6*ث*PثS6*UٱCYVb͊6)v^*Uxb͊6*ثb͊6vlUx^*ثbͅ]vl ث\ZX]usaWW.偊N]1V͊`bL lUrZjbjbjbX\VJa5§9TlRO5hېGƣca: a4Ya{YLR}V- 2I\N^)v)*+%B\ zw |q<  P僛[84p~x*ƒH1E ZpQɌ@PGxyUZt&iT8eW\#-Ua|U6"`J>+]F%Ɠ\ )n2\@2WUi[H-qIriq9F$f["bd֘b^;צIVb-f9#/E5(튷*$[%7; vŌ "Aos&!?nnl`#5U t`M N¾+d24ֈ} C+#n&*sXHf%h ]hi0OyUv͋DI2BGnDj6*(vpuo"#4=:J qFTۓb꼾*~2X(t'a%=6~L4mӪ׾6H-qM>8GUGZާ~t.Gf3!VZuVXEOO\, y?r)_KnwdMNdF`ݞk NmJ%Qv)rge> 3Tշ%sT9؏|&&-Қ]O&9QO $n.8ȍKpB*F%KMkeS;6urWW6*jbLUxٰSqKc*U+qVaWeWu2b(nUUp*eb*[Q8tʮ)pG]͊qVU٫[N49l mqV́.͊vY]bnjU*5\hxZ+EliZg bj-[~9 Zg/xUJVv@Д5WrpZ U+o :HS,8kgaTiPZm%1V'Υ[Š"ݎ`f|ۭz]1"OZ}g'@|s[1$}P~d;o-|?*aIUQ'6q6@m|v(}9?Yqc b-#1Nmw1qJ!'s""l_%] vڸy/@hrd4ת=c11F2l1n& *q We5xIԉͧݰ%7ق""` n'J)+p"1;L8P\x뙾ugCv ncS| FEɐl ג~6+"!rrr +LHÃĊ0|7c*B-cZ'*Dbeq AqVmRx(0f[h&-*q̱/&1$쫁剏N:%B\hF6x O 2\Vڧtg%ĝ%*>BVW(`VaUs`U@k Fn# g <Ƭj@'d?W o!'57^ kumiƄ%` wI L@Pn\mbŏyS*|u˓ d7dSlCC+05ܫ\R+ I< WUQKeH1d%8 8䆣,i*==6kh]A?,0%VrS) U  aN> t6D:5] );σV3lqChM{AvRj}BH`Ր Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6VWeSvjbvjͅ.]vlUٱWf]vlUٱWf]1Wef\U٩\U͊͊6*ثbeLUٱWf]vlUٱWf]vl)usb]p+YxٱCSvjb͊6*rEXrC]1WeW,bUث銵\إ btZ]1WW.S ]\`V8 -f^,櫰cN-jnbdFيYV#} J.M9JrhQj)j0}^`D_Ǚ.9M؎#N׀<Ï roV2{f)*%qTDqblqblM tPc9`J>(ckU3blf8WR>8_滏GO9( ((([ uB?x+>4\˶zkuXnb2FLIY,W0ڵ1p9L\) uIDbZ$c s\0Mudy@sY RֱOp2K(3?zn:rmQUx@}E}sA|Hx?翝 Ut#Ny_Y.ڭ!_-*:\)MŪlUFT5DsO ";~%6ԛ^Y5˾ɪ^F=|fpSBuǮ 4:p"fVQC\8Wz@-|dZ4Րz]  }Kʔwڹt;.۟כ_BBUAͣj*F^f P1<'WψXVaӸQ1F)\q%iµ9`↝kSWn ,qr (lLԦСrje䉵vģB.s^FJZM/ep8%$RӚ鈦5Mc )*BSJw$\Mp8EVR]𡤠 Jc +[LثDS+v^$+#\Ö_LolR6(v':,U( mKMDmڣ4[l+Q5eSJxi+bU3bDo5p*rU$HFNX!bk 푥۝d[IlȎ!\r(j|r'mz' _+O%kn#a\2Ɏ0QW>q3g4G-aq\2v&KѸgooeo%9K'5TӔ#SJM{d~/Li$UKmf4FH[EEbSZԓJ*,)65){S#O[1Z-YʊjW'(APw;y% )KfčV< uCt)"eBC#jGdF 2ZMmuPn2g2|.Q-BJQO$`3xZAsW *9by b;, Òu.'”$"b58T$bbl L7*4qCT uq-KUƴ~4Jbe*Nnҵu`銸Pw8YR4^ث:@e|UlMEN)nQ+rk\UعlqCG#'*u;b*=)ZVd'sDz Uev1WW0bWJu'lCSx.ĆDc}VC*]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y6͊/vlUٱWeUXUٱKb͊6*ثb͊6*ث銻6v^(v^*]4sbf]vlUٱWf.]vX]6*ثb͊6*RlUcv^vlUxGvlU/\Po6)qR*b(hfqZ^(.'/jxs]\prZ'1hr*lxLRgb`-k7™8`8ӓ}vɬ&hvk%t…*mi*ˎec c2NeɟnV{ڊʿ1u5]Ue0]~06ǗJ#qUh1Tplp%88,i9LJ .V*f[͊5p텾r#H)Y#S+%EE3)smS"(i.]pC2T7Z9xᛶ*XG/͊+q$ 5BADaZa^*:|@Z&mBrϸGly+r"ѨR[0g=I\Q@6Ȑyloޥ[aLZrSn5jAJŮpTj>f!,M ΫBVg66NEIz*y|# XE1jo dP%P559>hm2So?k=P@4N)rIpO)YG8>+Z5}11ret&]5,}C9t.dG0_ޯ'G o-vJՙ1ױ0#wS4V>4()_*hRVQpj M|'o $l$5pTE-n]?*1tyle(zģ##&hvd)kjE3#k-F6\~X}&FZ/bX/Kr]bu䨮ٱ;!Ăvʧle|Ky[͊6vQl L S 卫rwT­qʭqV'WS(UNӾ*V*qU\U٫(nGpqJ1l mp%eWo*U 1CvXR \8LU NjPlwmzxx\PZb*cJ0d9d aQM@`+&ª~ز*o~\ћUX|!|!c_>oT@Nj a]4cs`>bԒm+Tq5fW͛;U9sWf銻5+ժp*lwWƸC4ʎO)\6diܜJ;@7Z\e'b`-ǜ-6-jTrR&8'Vy2S9XU3WZW.U+sbͅ\3 6*ثDSZFjaV+u͊bGZC 8p]0+`f*S/-pE - *< hd^."yr\h$W`S81UMUkR0ڭ厨qlIF!E-mkKG]S5B]+5rи10 K*1ʁV27ihM\B)yJ&;pr%*+p3EHhR-Ǐ͞kϼm]R!u7ťs\U5qU2WN^#劮cIW򫊯$bQ5qVY3W ᚸfSqUE-$}F.vԣ~1j=GCa~^.o dN +V5 lJ"FAF=71!э2bJ[8 *aGl\0*NK^¹2)G&4 偆ӑUpnξ9-w`Os37{n=[A @=r֔'@R%"`WcN*|\!% Uخj7R)Zi]h1WePM-NUٶ + +ӉEw#v=A{Wv&d1=pX'v<~ +f)]::Z⑗s]+x Wf]]WcÒ7Ądl%Su+bp^T8U#)oqʑ-\PA–⧦;9/\VqXvQ˩ZǔqWfkZ-iLULx]*vS/VQ^7.ƨޔ]1j:fQ\UiȊ`Wfdl1W`mO9?C#$O~TLثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbMLR/~ڙbPc6*^*ثb]aKWf]vlUٱWf]51Wf]L ]lU͊k6*ثS51Wf.͊6*ثb͊]vlVLUXUU٩/5qCbf+MW/usRT.b8UبvlR㗊1VehpY P]U LUZ PW+A9,Tt]faթd$- M 5(J$zO1e oIeW*dN£7>XVWʦJҷ9[(QkԂ;Ɂh$$ ?@O>c2:0 + Oᒔ?Fkͼnq=%lR:cdQ S"lQQh'Q6Usb͊6*+ӾII鄾v1cC'siJ}s)iZ W2`%KEC0!٩]%uuo,aVlU[DaVgqL ?g5|:▆vb!E&Y,jI,+\4Ghi?Q`Y Gd'hZ Ŧ).yr>8㌶S4G0}Xs=8{^jTV((սY]y?N2ʁ]f4V@-Q)4wv,4 m3G#p^Evڙ:%BIk&531n:&b J" F7J$gr'[*7=D{ Cz#Py@IN`^HkZ`!Q]cJSG/{f'ݻfl3[y }Oqa-dk$td%t2܍<)B^9(d†aIkF4`/] h h" o떌鉋krG>LiZ .-mj.f+bGlL^x UW U܆WQ뚇:DU'jb6[(隸(⫲-a8cNleռ8Uن*]0++VnjPp*uiZ8,sLq[[-z᥷LP!4K4H-hqS60 SQg]DU ذP1hB0tsENv/$piaI4 u.lRn3~sx* EE`dKc(ؿS)VXuU#(TB5Fc;f*;f3b Uo,bSdFʨ;]QNUsw%\a#/ +jVlUai9xUnl \]0+di⮦lU9LثWl*`1\| lUjhsbWjRb+(o18呾*UZNZVvbp+DIZ"D)㚵+B.1;ZǑ^UVсWezEv8]hzmCW#l&R\S *il )vɅA冧LX5 J&8d Tm(%6]RFfZ <ΜO/ȗSi\S4/*DW^(UP.4UxL4GлlUޞjM;^(hǚ¹|\sVTlRG\A)GHdd>5VC*f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɿl(16*ثb͊(eaWf]vlUٱWf]1WeWf]vlP͊ 6*ثbf]]vlUٱWf]vlUٱKWeaVWe͊6vX,be(vlUG/vlUٱWeR͊N;4NjbXqaU偁-W/usb.R9c*9\p I˦*rKbc>ؼk&|[~ TXAV b-n낑h["1ε_;d^KOJ L#QuΔXSfl3{Pb NgCN9O/l 7vª\Kl[ 3NtE: }Q .fcĴTvUTf|^sgvȲLc[Q1Íc(`#NE*Xتثb͊|*хu;!r^ 9Mr6̼fX+.bɲWcp!ن*uqd%٫*&N2,]LPb1Wc@)v^(vlUٱWf]+;64+QQ1wtq{<(ѩ5*68d$tG|oIi9Jd6$k,H4c0}ؐ+S湬:SlH|,PzPv6Ao UЍ6n";7^ ц9 UW%(ۧmH~1O6JɖqۧӖ=ڶWm@r\j+e'\Hтv&-É im%-䕃RpZYXfvW.ǐcB"Xkojv9Ȭ#4މ$!@NN".iJxfWVE>{|F]81$UHv@ą#9׶ m;ļPFSpA%U>5l*?ٶdT*bud!%⴫T򮥦7*~%?l>G]?UC-AB?C I=Z‘!+xzdy%S*RinFn51KraU)+80*6)vlUi7UVW S(H[F)oF*9TJsbWثy+)L*(-A04er8PV9qUW$LfSIV1Br,~ŔJ ,PŢJUBY1PyT+I;FaXFsS*wr_/iN[s<{fxh3|&Y7 ğ;w 0$jÿLg:3h/LmiV9)U1UTS51B.IY\ 0*rVeb)-rK|UNYXu+YYWXFl*5L]\­fqVpLث U6*͊3b\UYZ'6*9x6)hث`\NlU6hUalU®雮*P|TDG+"l`TTo\*:]b@瘜4Z T$ғ\)QQUTS(`"#卲6Dv'!loL˾D4Xw$uOљ- ~3a$^/}szҹWNj*.4UzQ8⪁2JLmp*V*UsWZS.mU2Z򫊮 LU깫Cb5˜5M@7!a vbJ}yP|Jˉsam {S*0&mu9XS/CN# -cAa(az֡. OYOhˁmǫ?c SWYLimLm6#++U:.=K/X?W>Ϣ փ2\frr~xRġEG銻hY0!B >ev:! )o-CxFjV(ؓ% دV5RbֵȔ;@v7v;&/%uq/@O(Gl]\QCvSKT! 68 cJ0ŋGG^?|ZR R1I*WbILU٣j⭜TQqk n4Qc$QKCklUp81CXvPLUOjqKgF1VǏ@6ـP8]\@=k+uv *9r wWP5qV͊Aqp4]W As^[05QQ] Wv(.ƅqWck3TSY5$ sqly~K߽eVN_˂;")IE}0񜾻 VIT&^l?17[z`c^"0|I*&4#q6$Un#Q<1LC\Pҟ<~dBMs6p>OUTOG9Lqq)2 ReY:`CAB0ZN'pQD]*ˑO*uq*)*TQFܱQ^#]sC'I]܈–6*Їq[t}v2VU t8[iKYp7CLdHxcUlU>K>v;F +#JbM\>K)iT~i]  +)-6rO\xVr$IҽWlR9֘- *7;*f yiqK W8P־8V銩VZ#"qVӦ*YA*bGÊ+-*ruvS;)*QA"〡lUC []ZW*F*\21R]G{ z?ZoOȎTLثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɨWf]vlUٱWeR*ثb͊6*챁]RVlUءٱWf®͊.Uٰ+b͊6*ثb͊6*ثb8ن*Uثb͊51KYxٰS]va/9ck/ (N:q0*rZU0Z8P]1VLR9`bW,.*:laVc(T$D• dڸS+[\ثG)+c3)W1 2+և|T$SoXhB_}^d@OqI%Rj6E/m/~JOdS3NLX/PlNyUU1l UٱWf]ӷ|UiSD;+]HaJ.}d'ڟ.Jl3*j8>I@xN cl b; P8;55pR(\v8WfG,bRPUٱKbebf®ͅ]Wev^;6)=Glul،3N/W~#9w [\1ߩ_0?* l7 v>ӊj0N]U(?s3iMO0#*nCHwcJm* . >qHP!zǶcdV%wYA_!P6pVsH"bWڠ ˷qB1 0mNݜFjS RZlub:]慂6:jf<|p+sѣu^5f)A*HECr9)9HH4 Tzw!Qn<(XQHi;o!uHG&#љ@SihETQ+<ҭHOUQEJc㏞VoMӭr16R  sn\w۷\̐Δڨ}^!r˱߸«.L̬yU$uƓ< *7G0Q2E@sF*lusq]\aWW*!ڸ i+QH]6ln*r*y[b ثyGvlUap+D]v1*P6- Vj` qկLZ,x"PB6!j*:`5b'*\HQ*${l>y.wOJUVbjgB~~y|?#d^]:3Y3A݅pƧN[”Dc(ʮT$L*0F#sQk-FV*PeUMͶRhSXE2*b2W jbDqTB89|+d-(1g3blUr.UqU̹Xf[͊F^*8nVk,bو\Njbf[8VVw[͊V7 3b͊Z[\UrVV*lUٱWf]usbFhu3`Wfp9ueUrET_S6\$LUQd6*"هP#'.QQLY!\@2 :eJIrˣ$ZcbX$vB\m@'~#j`ʈMzKuLڟfD}L$|+G~ Y3LUpRUW T M0%p\\U*K/q5qU<򫊵.8Us)(S.H91&Xu+[2rc^v }3Sqo ϶d %4mELhO?.-*y U؋*i[p>늻:;S|UڸxA-v-[KT58D}C P9qfv(AaV1AL*qJ*,⮮Y@S{aWeۮ0Bw.' zbQ!]PinF&h┠|UT׾*EsV|CY*r]]Pq A[Pb'U8C .δ[}U)@lU .QKG(Ǯ1  c#*S 1Z8T@,nH$22V'!!S6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^}ɾX ͊]6*ثb.LUٰWf]LUٰ+CbW/usb͊;6*UٱWeKb͊]vlPثW5qWf͊51Kb.lU\UQnʮ)v^(v^*XWf]ZlUtYt rkr,bN;sS5)v:'/Z]0ZN< Ua9UZ-U)Xϋ"C*XVcVL`Ca Uc[PH*rb~)G xbt+qIBOBFm5!sr<՜8*lcʮ*N* ت3bb͊6*w~0MՍPs:T@c¹1g)շFj%k%.Z|yPf>.p1G$J5HDrJNAu&9&T,fͫ8<ק}7 t;~%,{f)c_LpȔ8J;K6+l]iÚ\ v;bPlUٱWf]6*UٰS 6v^vlP֝v9^en;B۶Z)k@ mnx.2 !*RkqRG|0נx K9DMcKPOm~ AJ;3&*Rw'~J(WöB1!.DuP֧|$Q=IFc$K#MPc<| (Vڭd]I5z!% {dǑ SɜG,-K)/zጳүj!O3"%a5Zokwhn@zSDJۂ}1R}vSKHeQ5\m%E*{v$* L$ђŨmf6| ?IEL~9aي/0*b3uV'\2ڷR4+2[k[82]Lptөc\U2K`eW#5qh kM W/CT +;Z ­2SVd|%HE0T5̩m+nPԣ-ffjCl+\\FaUn*Niɽg$Nsħ'*w'Cs_]?;<޸f7&o@H隘P2E ˮ\*qTJK^V†4;bdcRr҄fpZ cYq\m0UfQUT-1 *sW,VV 1J[2G6*pءإqVbS5qWت6*3b͊aU*5Z͊\ثD]6͊Je͊+vY­eblU/ +h*0+UXڃ50*V^/W"U3dmQQ[18-U0CUk'JfL0nDy\J/u1ZWJ`BfQ-*dz^-[7"!zcdUUzȞ4y5&2`2RQOǀ{־8ͅ[*๰%UFQƕQFQ8ҪUJ2l&W,UxL[WwjW V K5qhQO ~deiiGg.@Ą%_l*P: [q+By! TqQ0yQ );m!%X¤AɎf]'cf&H8ht;FASe$ShxgSV UFU0V͊ӊFru"GW#~4e^Ei"+tHx{^!(jS R3F*hE@س8ȡ>U(+v­8[$Tl0*k.P;us2)$. xRPGCЎTǻ>XRϵA]L;(Ap8clnp7'EYhPWc62a-S)P>E*x*VĽUS +rI urAȱ녓O*vZ'#jP1Wc ' 0+ƃ|Pt] Z8­e* 6t6 c*c-f; eUI LUr5AvX548)R6-S6=WS8P]\k`WW5<0ZoO~TS6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^}ɾZ ثYcv^*ثb͊6*죊]]vX]];/hZ͊vl*ث]`Wf]6*ءٱWf]va6*إٱWeu3Wu2VWfxن*;vV*ثV˦*s UኸVVKZ Uk)hإuqCG,o'.qhpVp\Ukc`J6(qB>?*MNZ-61U:*9l0!s *cSF6+qUbr(ATXb(I$ |QVII=B5 4t.Tx*๱Usb[͊6*ثKt o\ފO3=Ku()l3yNcv2}X~ZB5 dpB'uQ@P`M>[ZӋ;u'(xgV;%&T7rTM/o;]И+^/~`^ I$ O}KC@w%j>*>͆drMF,v:˘$" Ty| ӈ|["u*\'mw1Te(}q`BZ͊1—eCcJ+US"W0\rCYWf]vlUٱWebfvlUٱWf]vj͊/vlUٽLL Y)Ҙ\~#L82,-i12`<$%Zᦝ57 f6H$5:/5%^|DEnpr=Vz)H$eS|۪˘#y΁9*Lf$96TyZeii<)?4[)|XJ'}DQq-7]F4Zaܪ/F"t{R+f:&TW).]*T (U#BF h&LlUBX N#K%EQiݽ9sUA2B \]6? GF_2VyU0MQ.lX4*iԴhP7dUf2?Fy~t qkZr ҙyVƻ^ɋ@`wH-QGP:Kc]-wkY">KJ?j7Dת2f(/~'Vсfp ya*2-LUUʮ*Xt'[N*DƖ­[LmN)]LWS6*f]*q8C[LcaB|2A-r*aVb0!al4GFLTpL^sqWR IL T5bP{䮷J]3t˿+?|G  >^ <r :cdS벟>cE,[|l| Ͷف3ezmi۰@ʙ'Slت`qVXEb1UeS"(U_,ˮ*+,)XPqV1W#0=sUPsb ͍!f8QeU_+^sbNaVͅ]cvlUu3b͊6h9Xb͊6*ثbثY\U]\ Y®vlUo5qV^)vl qC1UrJrQֱW,d TbS6]Jeb͊+"6i2:ڠhn[L$PV:Y~o\:-8do/:d=+g=3/M̈́Gz[hsHЛ'lUxLP.V*86Ucʮ)UWW\#\U]qV<bVrJO]K^ ,}H304dzSYK0 s)fMVGӖ**1RL 3)Jnru旰"cX&dFO? y@ܯCRW:u}צb۵Dk0ES~!\S+^DBcCvb*CdtL3Q@&sxsDbLUp9O$2-BYm!(q'85{bƼAE# ]\t\=us(voOm+(]We&d]p邑7 cT2>$w-fJq늻u'񊾟\]0>eZQc9(\]Yu1*u1̬ .*1IT0WW+Pm.N۲]:^ڻ- 6,$jSqڭ[cÅ.G^qbqW i\UBzbg ONGF)k( LUnbRep8Cnk qWW(!Sv<_,RALUc#lU-[\Pn~aY ЫvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbMLR/>۶X ͅ[lUZ9vc0]6*죊] 51WeWfG6*ثYxSvV(va]6*Rث`Wf]vlU٩SvlSN͊6*ثb͊x R]1CU]bZ9WW/v^ur)jWS1Ufhk/0 qb1V8m╧1VXZ'\Ucc,E8.*ʇ51K}wpSl1U/hٸZ,GLI8"==z icxbR\cw4-L*Ex(osW2y1"LbpAUX6i"D BE\Bs$U."գHMchh>&[XXI|h_okQ2Cs-Mk߷\$GWB;EVgn@X0h%-)-gXM'Ji_ , Yg2,z1N@ b2u1YpAV\ eVڵʆT`zQdC夢хj>Xj T<-x T*H?N b2%PlUٱWf]vlUٱWf.]JJa 8C*UXb-Vݩl/ÔvccKba={ԑ| ĩJ{hkvV &z LdK`X%}n;|<?8>I%0ž $\Fq5c x:doQ%{#J9/7V3ZM PHb$7T<Ь$h K,5mC0jȥv+ČAܐA!T<6;S!6-zӌ[z|0st q80Ĥid*'W'&2vqT=xT UFXEM;ccțT~y#+iI(T<Z9k S+-IPYZ d"H-h؅;sb!YLOMeq+z r5H+a0${~&UUiZHy_+S̷2 =GJ.x+BkƞX|G/B`gTG::L$uˁU7PvR wU (ciq\ LU8RV7qV11yXsb뚘\1[h pc4E18%-p-'L5%x9\X𸪑c ,qUO (Rv5+)T.\P$~Vcb*:xeS0O̯:[_HFYYc@~/Jl˝;hTGm+66|w_˩K};fg$#:M U1ƀ~ymf :e_Ս@*1;fh o,Usbdˮ*Lb)X bn}r`+ʑ\sW-+iLb XmT+p*G+ ˦SUiLR*XꃘaUs`U6;, 쳁Zl*͊vlUijfWuͅVbvlUٱWf]q͊6u2VZqVVc5]L U*QG/sbF*^Ur Jk2S.:DsjJyUf_h[m-Ai g=Yjc W+)d" D[bPmnqVn]sa%Vj fFltx !HZUʝ oS^4}ʮ5p!P.Up\i8)VHUeLJǛT [ 𙫊UqVkjhl*LLy*V{~c)7ij/ hɚY]Y`ȟr3-g^>DU1o,|U؋1`@l@C-7\0 $( 9t޹dXz裦d4)[ռm_cJM_FI:'A— (:ĤUI\&UHN(l"JŽEpvR5zb'p!qJbI!O*1)nX@QJj`IvSzaWe1]\dH;1WeH銵\xAN9W$|0+$4⮮V‡W4pUʵ p+tZ֟ S@vA]\~0+A8cV#8rI[LݱWfq.+ohثC(081vQ[b}1Vw8 k)9Sv(,UtW)Fp=qV0Ǿv[|U*z]bIJS*mh({CPG\Rふsp? ƟOfV\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbMLR/>-Jf®͊6*َva]6*죊]aWeWf͊/hZ͊,b͊(eRثb\*]٫6*ثb͊6)vlRءٱWf]vXYxbe↳ Uxb6*k6vlRqWp82*8bf8Y(hp8uqVXV8V6< Ua80%c6(1Ǯ*R| ,b+XW)q*~q64ªl X< U6*x%V>#J[uF Cxϛ;+ CZV>͊6*ثb͊7$oA8X2U۸bi`xsiqivW Zdfo0d%?fHPMAly~dwzv#UUT*]Y,lLYƃ-z*H\皏/g*rh7\CS(?XIҺ  ͆oEͬBT!2ɔO"IfKis!`h 'S&d(AAʩcYI,~lĘd @m^WrECwl0ԎĥWI$T =@ ""dFB~c JMԧlW9[JLءٱWf]vlUٱWf]vlRb͊aWW506gvV*UFvjbC4qRG](0UEƔlwU~Ӌըr$2⦄G(pu\ K,K:hj3D$Wl'?Gіq\z)<%,L8ٯOY E T\b22ǩ 4̀"y*dG?ƅX|,, n_|ܻ%LnCpmVʋov* I=rrnHQ*a{U,g'-W31QvS@.}8C,f&dH-|(uGLU1ze79$20UUٰc;6*[vZ*l(hpl6V0ڭ)S(50+jaE)ֹc3ou)a0,iP0q0A w-^c#Zv[izl$:]d 5}-Rʆ^ƕ#p{d~Rq6q<%m+>,?c^MҪY11O6֋(2p0׍IernF1bdȬab?q h\рߥraA Wq %1׮le, RC xN:bZኺR(ث 8v=ٗ­G\oՎADZVNUؙ;J]0|VE+$e Uܶ8p,npv* (k ȫ6RvS00$zL*6p|Uء'*pk7c| 0jI銴s*|Z8ZN*캓㸒pc_P2bd* *}ibˡ]1Wfh.ji(l~x0vP]]Aq2b1WeWe*w88'qqOVOd3*BlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$((^}ɶZ ͅ[͊6)h͊0f]6*]ShU͊vj\UٱWf]6*]];6*زvlUtjburWf]v;jWf]jxb]hk6*偊NXUp+ U1K UqU,bqCbcVr(ZqV V1LUM#\UDz Y=U+`V$⸪6*i(Sch̉)rB9em[ڬ1e^6UݻScpSےJaޣccFNE9D.ïzoM9?fB)2ʋ7GvfRɽ4]Vl?OdžaTEV3x7o<ci0^gM:;=^AgCW:v/,B>Qx蟜6$%|+&b>$k?W)}>NtLXjb[IQꡁa\J2 .ly#WRŘ`=Dl)Hq ha{y8 YdI4P]2$MsXç@‘!$ 濳A_R[wTTViYTxֻC|?k#m㲬sAeyC^L Jf Wh;~98&y0dԮ!ӟ#W9Lb["o4=9H&6fF"үPjG~~?,4:~9XP͊6/;66*죊,beWf]q Zqlf]vV*1VlRa\ jsW l+KLUhr\61Sqhof;9$}I YQ"agZr5&1riF%)m ) N[zJK_vbFbAE!UPZ1޽_Yȣ|(N YG)إI[aTtmw!3I4ُLXWJƗl$QqEk4..prKeDdOEh\*)"f)4iX#D30coM%T1UxhW`b+I5Ybkl* }9#(es2Yc٩VvFSHG uKw[Hv=|[ evJcRJ: ' <"APJ'sW=TMn&R`{PM?7^:MCi3/Ɗ4! #MP\BZ$ؔSOaeXu[ъEYp >G>EirUVNu.6?Ai>h]ƕkEv&ݗ1 ѱMq32+W>\Q@<{]M'l m -֕qlMT4!I U=cMDv¥¸c!vQi[͊*b1Vbp%WPep+EF89Z3siFXc b HDAJU*P$ ! lЂZ 迖ZVjUTу dG+Y~0h~!#( /GܝaORnaӗD4 !,?Ƶ;f;ei(7ZcNEQG 2W`UAu;#XW6*LBh Ī`Q#Q|bsbJ *E3aVL q_\͊ehثYcWff[͊WW6*^*r*edh;WbzeW \ثWf\2]oV*sb`0lU*X\3LU\ 챊[F*P1CY*f8G*8yc\6#9DB&?nUfV9c0 托6:^V8ӕ2:V&df(iz偍*Ҹ2TY.6:T;Lz1nT7`kؽh"+Z~ȉ[G-Q!ЍcLکP{ڜ*ڦVU*Y( VDJQU깱U@*`f[́] 6*ثlUf\(79VBM/7}fFVAa+$5̓^E~WZq~NPP (pޕqV;1CĚq]lO\ު1Kj—f[qWp!Mki 3:FX>Ɩ_\bMwUMna;⮮5 vc%|xmj<7=qWc`CUd]݊7v2O T<~MjOwGFu2=qWW)1 dq'5c8ƑL)vX8Ο,UccqW0)Q\ULv8uLjW犷\'*qEPk(]bͶ*qƵkLUs1#obƁ኶28q;bc]Mv8c :}> rCMY ʐvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^}ɹbP50g50+UpXbxٰ ]6*ثG6*lUٱWf]6*ثb͊6*ثb^usS ]\]\PlURlUٱWv(k6)vlU٩, UٱVVZ͊0.8ኵ 졊g n;1Jӎ*aqb1U*9tVS,'0%ccJxvcwRqp bFcS6p83MVGW㚜qCAצ=Z ebCŢ0=)kƽ2@e?;Bb?߭7+lMb͊6*ثb-hTTBlp)˗$19t{Cnd4+ϸ?a3`cmm:Qw3~C(4ibN:TGaGkYw\#jl5Tf)9brEq:9'%i]?v˹gQ75\6;1E t};]5n ڡ~Y2#+!6[ ޢ!- : d6U_B8.MȐOݕ u=͠vsOmLJY'6^(&px7O{ɢ&hTe7 (o1˾G,j6TMZ|"9|5-jsJRT3Ĭ`tL<آѵFC^QHPi_'3@-(@T׿_zѺ>$_ )"J)=; ʆR9+liL 'rALvH]LZD⫆7vjb˦usq]\pqWW,E-[h=cVmi|z01Z1+mzq׮4ZJ` za= ;E 9/j*)OzmH#m!n|sO)YO|ըy1%9 *%XS!5Fivy=d6=3MB#^1 S\ [嗁[6*3bZ%WcU6)o6*8Ua\ت3aU1 Up9Vj\*2+P5qWfvj͊[8ӛ LثG(Nl*V*ث^* qUXWe*v_LU1WeehSk-vLpثVo0Pc(Pȡ+ mr@o|q4]Tr)Lʦ*8r%:(L4 匕!@7NJElUNZc!"M~\t|.hs:|5)27cSt|*ʙUqUULU2G * 6*Vb͊6*ثYWS6* sb >͗Փ?UZ.r~;ؗ@ p 8]ZSqI%)L(v\ua[9a7Z zSqk'e늵Lgփ*bZaCx|[—b/ÊF\lXTbN\2B [8V*;v8qxŠUur4R jvPx7\ut߾hY|qKZ`Av9jzf7H=1;jv0L%Q+)ii /Nٝ 7~UĖ>+Ƶ8x;U#*|IV0Uvg'FcZF;-z*q2MFusq ZaV<68Y[U1Vq5[T;8Z bcJ]튻(ԁ\U-(=*3B:hm&WnqW 'cLbev;j>8b6\s'pѸW \ !Ie(U͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbMLR/>,JR*ثWeUٰ!xUW6*]\ثvlU1Wf*b]vlUٱWfvl ث`VثaWf.͊6*ءٱWeS\]\Z^(vl)jWW//vlUchUnjb́]bv*Uw]6*ᕊhU2F( 1UeqZqb68W'cQ•b1ت޹0+\Rj/\pP1U2cޘko1S bnsQ*I ޽JW V#l)jQQNB:l^Gx BP"yoՒ ׏H|.TXԊF_ڐbYi6*ثb;sNt+٭㒼jfS+3󶳯]bF\s)N&8' ^UYW-qJ_\6zc%9 ]{Q$ەxv#"f0* oo\ǭy 2}"zriSFIt'OE?e ^9Cjd Tz l\wˋKT꺭s^Zf4P)kfuEƗ8.K/R$lɣDԴ^k@}Nh=;ĖLvPbn 87P%zTW @E )c,l7P䪡*v 2Ħz{gvR$'8ݞuŭcx1"cAHK^PH.X2袧#yfL4nqo,ݡn y?@=ƝlhG iPPA"RBV卲J\B]\ e,]7.LPjbX銵qKbf]qWf-(50yX+RWf*P2)o/p!l[G%n9BFCU$bEݧ}9BU@o,:`Mf&PRR՚;`5pG3*^,ƹLF%c% IF.|bg}ZY.V>by'9QN"trJ_.X2x\Cԩ2zRzcK2),:tb?c-Sָ,6R4e~5?<<iEqFW+I#*&ڤV>#6,Jmkm62~)KNǮRXڟNQӰ#:LswBkaV挍۸1זhXc\2Dsn,  B G|Mž>pzd0ߩG]h 6ǘiecͨ^ L&&<L)QH=1>5\v۾jo]j9uevX*- cIhV⋈B lxaVflcdP^lpK /4܋Mǎ`'{2_A:~z"=h~y<LƠ2S"xB 2d2֥yo\s 3g.G´|$*Xl 3`Ln*7b́W ­Ƨp4ʦ*5́+f8XU܎lUZ#6*F]1V9G^2V͊'0]*9 f WfSvlUb)Z9gVU͊eb2Z*2 b+ rU6*ثbͅZ95qVT®ˮ*X8 u3 c1†yxyEQX,إY^lUXȪ.0QƕUfjdiWfͶHET'6J%{U1!ƕsS#jollrIMru"wT{h!h)ƣf+J|sNBv RgM\BڑLOlkILi84JV*f[͊6*6*ثb͊6*ثb:S { 'Gv#(MF3ȥBl-)\ruvWP+\s4a{bW1!M+[qCj ClUq&u*+!*tDz銵v®(qWW,lUy6향3bWeU٩, ˦*͊;6*إٱWf]vX]vlRثbf] (fev]0%*ءٱWeW5qWef]6*ءٱWf–b˦v]1WeZN^*lUx]1W jb#vY]LUqG1KX1UF* *w R< Ua8 Rw˦*fWou(YÎk lTVҸp햦`W?]+T.Pۜ*F(*_ uhp*nƣJBY%&jvFT>7*,{GiklUٱWf]v⭨{V4f`2T-CD_:!E~A9qlywm䑤ǥ>I2VDr隘٩G|*Ui9%ܳ!ȪUF597"7rb,HoeO3׹@O lĶ"9sk~97l2zPveLzR08oh-&خG&7zfle0cdP{]Z'$:;,zgp: ͠Bl{^`}%Z} q9v oԍZ`}]ą*?=\Dp=X &5_L/#[/KQeG Ńo-\r+TaOLмiܥFᓙ Am)E-&DNA"rPI]SI tE N#yʁ NTZ$r_Ω#r7W?0rc<2 b ;Fv gHN[vs4*܂*=3wq jz5ٻf+İ1\ I ;6 qxb͊6*ثK]͊]qVj⮮bp-aWf‡f]va1'oqKc*Szl}h)Y e%+L*B)Gx)AcɰIK6oJKWc$5 3'ă45ǥ vxK&#RST2U)dVE#э탉Ww-=`务Px)@] !gR=M)j;g! vĔ:+*wHWK@8غrdaj 8Y]vor9q.8U(љXW1TRhp'bv#r_顋&2#8 ;aL+2=bܳ~|$K={k U!c&&+T< .t me F &F,TƝp1nu%٫ө+N_:d#e\p|PP6*¬a\!VtQCV dJѺV\ sȥ~`m.Ţ{GNIYd'yWӥpy5镥'PXN`w*o]f$3-(CErɓ[Fh+#jD(6 *\pUW\Up\ث3VUk6*frXyVb9Vk3bVZjbWUi;/7L*r늺VWheblUث\FV*Z͊6* s UٱWf]LWv7v8`WeeWeUٰDb\Ujf3VV)UC2 5wƕyҩf *ϬZE0*`FV8Z`2TL:kHjzeVJS{uh:R*t(*h1˶[W p )ȷmLֿ@QBOYeѺŸlsB#ʮ)^19UTƜUx\إP.lU]vlUٱWf]vlUٱWf]f;j-%4K5wQ 3\27P{)]Ul]̣sQ&r.+#\Udž:b1ş`)Z:c3 o]Pװ[`F*e; WSb ]Dj1VFwZ8F4gj o5@%p!CA1ȢciWS(Pcje(f>@d+k H@6搯\L[]LB "㊻"T!n|8ڻ3 ba}Q]y6햲Aثy6*Uن*W6*ثY*ثb͊6*ثWfbf];6*ثb͊\⮮V)v;vl*ث]Cb͊]v]1CULULR®͊\R3 Un^(vl ]1WZG18V*^*2*㗅Z9j1J4[\zXSc081J1Tblq RN:AQj 2VSLk qmU6g}ʑaSVwߦeZ.P SYʆZT₇"XC?^F\QxNHow|˛; hiilUٍ*ڙW'-N[h]O/i59Ϝ*yޫ?kh>8vt20R?L`1W9cV땊9I+3и-r\f8rFcr!ӏc$]st8i+N|whU`|Er*z*}0Xv)? ?Vec m:iۚאSĴ\ufi44̫K"#ZޏjpC0;}G<)(֍HvH*7#~/[5͘& cG.twR} ~׺4h6uZ7sNntԃI=ɞ|mvcmw پU? Mj{Zٯ'M`@kJu雕1[]@6'|kJi]R-CZQmjS#.6,͊6*ثSvU1WeaKbWf]PV2o6(vlUٱWf]+ 8V8 [lUp8n$CqeVa&熲33BOШeӾa'6 PZ8^\^y9(@Pyљ"v]Z`84 /Z0zQZ|6ϛ^q_ IƠN\@kzYG.~Ũ$Ÿ(1)BMkTPqͽ)?O1JnQ0^JB=|3K{OxK WG$:+VjqhA)Z~,4QkbwyLT"]H["&o{`)Et_#!׾L*B5/,OΒraMaדcVMSHjeBCv7^[F=7:.I*7n ˗ȈT\ɎY u݀rs T`G5k|)l 0%``5\2H Zq(jY06[ARaS$`[~L<0]}|sgF-$o1來ToƐpk&7lP;4Vrz; #->ـ NĂ@3d J68 rʧ(Ux\إxQ^ebw\Ui6ju3b͊W#(bW6*lU8ur#Ljb#+ 9p͊sbf]AulUٱVf]Z]AqͅZ+G*UG/\GZNV*lUٱWf]*LU٩]\*UG1®͊F*dbr7\U]6!ҫ lU|T^([lW+1wR,F4TJvFYe2T;s2b4#Ԍf(4-čFDsdSFCZ[kc=?S)M5k Y%oq˗n2îoc*2)\Ux\⫀͊lU͊vlUٱWf]vlUٱWf]h[#~߫' VK[?^q@pǹy<޷lܢCVjbTŸm˶lU0rP-qVPbbvZlqZUNVXOSV۶)u1# 0`fU튺Eh+])רZ*$⮮`[&Ϊx*j7\UQ :S,UIӊ[Ah07B*b%CwbUQN26۩\ \Pt ero\ZJAbcjy9|]+IZ(!]"ibT#(WoV$̿l*PUxY\Up4]$ \qj w5Z4 ow8ޘ|,lUذ Ui0*EqV]]\,Ԋbc )\B\rvn5늺|BUծ6CZb`늸}qV\U *e트M_m:Hd% 7Od/*BlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y5햲A6*hCYWf]vlUٱWf]1Wf]vlUٱWf]6*ثbW.WvlUxaWf]vl ثb͊6*lUٱK銻6*ثYK8bN]1C+b1WV+ebU0Zؠ,fXkcaJ8*Lq@1U69`bY8h덦T=1+9>aU UkLp548h\^'lUtoP*1BD$c(0*56Lٰ^?^F\̂2"rE{_'*,wɦO\f3bNp]u뿶E\>*/|yKˢ }|3 tD=e/)֛f͒'LVu\i#"b1V«HFh)YMȡW^*e*`0Z:-W #|aU2IS9nRldJhZlz bTմL.f@=+]5}GWKIwN>4eOQOs4Qmxh 8J3#u= *UC֝{W,3aW-zto;r4ozdGSީdHU6-av@x7?@~Ltzna,%Wep7TJ)(Iyz5Q#Rn9Q/th5̈g=Za-ŬRAB bWƊ*E:8i]\UrKSHªm&-f…)pdi7zO+is f܌IygSKhmW'B#c$ػ$zd| S¹3e02$*;`]2I>n1ǠV=C:`R?W.BHנNpeW L]L­aqVf]ZhUˮ(k5qVVq0]L+eb͊6*ثZ9xTVPYu͊Z9VbW6*sb U2VbW6*rVp8D6*V*ثbZb\)hpÚXxث UxCv^*U1C]zaV0*6V-iqb 6Z^UU" oL Mm.NPDSlu+ Ie&Wsu%4)%4qrm,"t)n; L to[TXO" "슃ԡ(FtmlT'C|UYjv9U͊lUثb͊6*ثb͊6*ثb͊]2NJՓHEyw*߯6yoK~vѷ0"lE5튵]MLS2LUA@I銸\UNjRdLHI)®eG-]Lo\liCAaWcqVoH!\U v-tlP RǹZƫ~1H 9 TbR6 LS  v>?p!5 cW}Wb#rq+uKzQyf \m1aJUs? 1K wƼޕ98xbP$DžqVw] 8ˊ2ph˩]K]X9j)\dU1Uȵ銶:cbjb_UOLUrUp9H',qVZbq;Slf|U]⭌pBۜUr\_pB\OƟO>T_6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɱY avlUc/h f]vlUٱKUن*pC RثV62Kb͊6u2%Qn0!偊]\*]1WW51KLU*;6*إإٱC)v]1CULU-W,be R;6*㗊1K@(o,`V銺]0ӏ\UinjR<`BVUalzUM<.*[*ƽ1ت^ѹ+|cLUL7«Y@aCh*2*㸌R1ߨ ViKEJ+Uz-1x()G0Lv a~םtCI^?.BƝPJREOZV7S.kҟU1C/ t-͊r*0m q+eaj«Ha+0!7SpZ+&23bS7MZH6WT1W{>SnĮa rT Ҵ?LHsXIqvcȿ?+4XOg޽{Us3XM;Sh?S|36߳sZA%b]]sY3-&!x;}eSbWg:P6Ȟ ~ R仉d7<=?o%v?l_?.)+?[7yDOqc#\,:zk=iA.0d{jD\yBj\,ƿݒqe>_e^z֣:v-n)' Hcl!7_H4v4WTLńb1;UXNb~#]hH5VIAֿg!QFIf]3J[;+֟ Uo,nln '/L+{nGG$\FlŒ)lUءG \sb͊.Ɓ]L 4U1[®ͅ\2(lf⮦Q]«U\WebQ[Ӆ[CqWW15J\sAK4 nqoҋ,iք.g#Ц@HW|+Z_nYD,Zc MZ᜺zwgӁu҃R0Xqw׮ݹ#䛷qʲc?O@TY"p܊uccªpBybb56wǴy $mbn ,"ÎO$Z0;8ɪSlG? ZK.D׊78f5P?$z4"YI$"0\r : rVUSS*[ےe^c&f\2 <3u9mUer9s.앧͗|I;hpf,꾄 @]uV_[}T\h^GF9hϋнi;9+M˻hY`b @f5@&??G98-FSㅼ V،w~y*cjNkRg)LdVP7' F[D1\6pM_,;M`>*ipzD`衏1J-"A3].mNw21\]FT Mu;mX cr*X.y*RXUf]p%pʮ*JLUF]qWe3 Unc]LVlPꑛ1[lUhثVb`1U50bȫG6*l*lU٫6*NlU\3b2 f­UlUٱWf®́] +ZsRULqWf+b1Wf]0+SvX pNa)le2Ki\b囎*q8aS MrdUl+*+ Vjr1*Y m" ƕm0jFgETr (=  K <7+4Z8UM );xٱWf]vlUٱWf]vlUٱWf]vlUٱWfZ'4a9(sAC\?y6o\6dƿ)9(ڸU51C7q[̩C\Uأ*c@mi4l S Z'–8ÊH@[lUiO|P+>t w8D#|h)Wk3v4*r(ߑ©oݫWcߊW)uq`”(k3Q튷Lk&lUƺra ]KY(>xS]F~QhM[|Pq(aWf/SaWU*ᔕLRa[*NU*⮮8]VUԃ)h˜UIj|V㊚onkqVrY7zbm*ፏaV w-Wcv9T V۶*6v< bkp)\B\؟O.TvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɱY a[́]1V!͊6*a.SvlRثb͊vlRUcsP.͊/vj`WeKY(v^(k6*RPإٱWfZlU͊lU͊]bejx͊6*a/vlRءٱWZqKC508 Umq6N8 UqqJӏ\P0*cX)Slp8Z)46UQr>b}(l]Uؠ8 q81#UDZ{m\ Q (]F)\R +I_x%ɐJӥU-lNTR/$>ˁ,lUص]JGFrmN,`{֟, l,m;OΛ$+_Oe>ቃTH|U*XUflUC Vfl!\N4AWv5ʮ2(^rT͊Z#(a\PV*FVhh؄nlƹ}F|㡙3@Y$m ߁5}*Z|9[)\=jw4{6=Wm͹g:?'m\i2s @:i--'?6- Ͱ-_Wg0bAԪّ,Xs/zxL|"":ݿ/M% y1%㗏RNƧ+o>3[c 5,gyq/.4y!{%>˩\ oI' RJq:t<ci׷:E'W6'_͕JUVp2 f޵}{x`O6*[q~+8l,duHlo?^/O1vރ4y 鏃Rwd$4n<0:J)^=|PWNcY -)LdUA­xJvZFƚ*,(hI5Z U, *Z.jb:o\r=V-+JU}E)*LU­f‡c֘ Fv1b][v8z̟ˊzG׿q& rRb}? ySFlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG$8(^ɶZ3 U.͊6*;/vlUن*إٱWf͊/5qWf(u2Kb͊,be▫bW/ur+b˦;6)vV*aV]LaV.Pإٰ!n;6;6k6v^*s sUXR챁\r銭]1WfUiZ -D偁VDžV1oǨ*ni*d娮(ZNU`Fx8Zc((p!aƳQ X]×LR oq aCtqBS1Uv|R RoW7Z 0( E \951(2Q2@.?^ 2 o/<+dQP[k? N h\TegfZGe  IX҅쫹''>ZVyNTfQ Y|!l#/k1rX %[;Hc(7U?]p*vV6X,̒VWWlp݆f«daJ  Q*rʜثyXӾX­R6q́Vͅ+@6*f;V0!)MjrOՈ6W[Z;w1ԁZ?+B}); lǮv, YVYQ. xUȤZە8gǗeIM (RqntOSz.i|(q,=c7ZeTOؠ*k2݊7yv#0IMvGYcg ۰8yG_JKHT%_?Onƙ_|ˡ` ]M=\l_6V:L­JTc-|Msuiv4+4<^~fef19^UNfe`E3[4^$>rMw|\XZl(k|)ZƦ4e%JЩʧlAiLm6:\¸կL 2]5-QN)][­NE-W Wc[o0 ]'WS*R6u3{ʮV٫LmZƲ늮F xĭDnl[YWq%cnK92-ms|]pNg4?KK!2,^|y]ӯɪ14CMkr~$ 8,Pý*C yj(mg Xss5l{Xy%7 ereJlWpo\ #) R; 9%x"**X??M, kO٦6MTbGZ&2};!AoʎrcWu޵Ley!W(Y&jQtB(y~0ĉ4ڄ-J 8vhjkbsBqH`:;e _M~#ǘ25H!5pAk^?Ҭ"/~p>go_]k& k BGlJ߾C!r1SF07ḵP[\{t1&3$KRKv^zfWnh)(UX ث3bLUثZkj51VSusbثt͊v]qC\FlR51VCKCY51WfusWj*6*lUmNUp˨\UG V[핊sW ]v^*ثk#+ ,`Uf8+hf[9LԮVCZjS hf-&B9]ƕau_,VAPqWPebHL*, \]p%l N4.BI TN̊J9R%W, -֠UG^ *OrQQg$Y2/O6ȍr Lb[qo ;LO#͓96k6*ثb͊6*ثb͊6*ثb͊6*ث~XB 4GC0߬<ɱz(O W--NHr9/0.T[1OnsW18U1T-WW6q)pcUڝ)z; *9]vZ8;*X늷SȄ(qpl^nLi7IWeٖ-zʝI'aErO*Ǣo\UeymlUق~Ȕ;5hp;Ѷ;bR]IkNpPw]\ w8%"Q\U٣"nrbd·PN+*e'$bE;b Xr*eLU$4r)hZ9|E1Wc@[5*JUcxG0Za +vY]Q\ ኷S]\h튻DUaVW\. pu%K_VA2(ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?ē' ߰>y7 ^*5vlUٱRثbfv_\ ءٱWf]vlUٱKb͊6*ءxG5qK*^** ث!ٰbfZlU˦*l vjaCWf]\ *fv]0+G,bW+n˦(hp-W6**8V-'51V Ip*6=F*[.ؠ\R#c-U|qJيWeS`TbNXZ`CT͵qVTt|RXS1U|Pۊ sa jVXV+NӚȡxv•6]v)??^ (@yr/x_9łhΣk* OCuJt3_^%mW6S<7F\\:CAn#Qoq8=3aW2*f­f]lL؄94_l:`Uf…c0jL\a[c*f8UتӘ`U˕Vͅ\sb[6)[ͅ]0+c6(qGlU>U~ 9$n )+Z4|qrY\wQZHɣ.@+#EqJO똱'SEc\ʾgb9lYkzZU[IbhFƴpI ӯ\|7|H MNa2.)_s/1~UiI$|#6kehZi-RBI xT7́Xi5KPU=Utb6\1XH턞kJWBC9{c*FRyH1HheƜ)leaKV*^*򰫲oqUٱVKxӑKyG Wc0+yx1I]'WeaV)v4vjWf͊51Wff&)vcS\r_tbrۊBGȘsPKR c\6TD!;똲ӂmZw?էW)0!=cfJ*t\P/-"#Nٮ8LFJQ6;yʠAJj"ݠCFeB< TܙOQ0?FG qO!}&pi~`n/Hbzeac̪2XpylZ7֘D+@pҵG*U:`V= 1U%H$ MW@qUUl+bmK8ă*c7LUv8ZF*o\*bA2WeSv:nثc5MqW\*l)vjWWc Iv`ivZusVArثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbGk#LR`|q,d5)6vl Uن.qC*ثbf]q͊vl*ٱCbث*͊];/vjbfZ9We͊,bثbL lUc ef]vX\rV`VثYt—f*^*aXi du, Ui8c(*͗LUcw+,wSY\ZMsR;⪛S/ت0}Uݳ Ul%1Ilxԡ]νq,fM+f\*P`UžҞJ]7٠E IV?-P8~dILw56.D?m:>\0ڄK6AJj׆~ n켇Pc_l >Ѣn?k1%MF湫kJi0*«sb́]LثF^*rVت\ lU\*fPX\7똌U7 vcVUثLUjbe*إٰ+k\P2V\*l )"8 ]ߗ|զ6V@E'tm~odh(p^&̂;o"4T;fOUOmFjL,j5퐞yLS-잨@d{VW<`$„:Ԍ%E?5ݜmvyNrK:\%;ib|Q6W&jw8nN! Su)]0!ӊ6*0⫲%[8k`UqVUpi iœc1V lUͅ]vj\Uٰ+늵us`hk15—{퍫 ԧ aB22%͐+eHKS/o9HxCQ^t?陂p(1,scPYy|U" "\03qkĬt5i_zaF zPᗽJ3Kxa\FU/go&0y,j@ceR!U<F" 8T+ J+(YYA,(*+eD+;k'thPE MYq!a|idwoF'#z?NH`4ot MO۾8RXhDo1sd癥"/8iiS-z<$ƻS1dv\,4)ͅZ9Db0%yZ8JfZ'1­eb͊sb^*UWolثFxÚ\UbLUxYWf+k:W V6jL[\U9XUe UlU]Xb͊6*ثbjrWeS (3b9Xӛv^vj`W \rsVclf*bqVjbp+Uٰ%``Wf Ӆ /j`WD%%Mli[$eSUeNnUd /ZI[Oh -㨞$7G!]y`ڧlUثb͊6*ثb͊6*ثb͊6*ثb͊syG}u+6ggo(ZAA.F뗆z֘Y5aWe.+v1T=Wf qͺ@U-ndw3([̨ <Z8memZ8ncl655-]LTƕAC+cˉW (b'!\(o—coLU*m늻1Wc*TCyC}oy2k}J-UqNv<ž8G4aCU!WbFU]+X8oQ .3^G, n0n_A*XZǂ1VSvXU؍S1A1WͿL*0+8*jaC\RqC6ث#kvXbrd޸sq8RP$;bƚe[®8[?6MrR>Ր\#6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'??ē'=z~.uH$1yt>Pc|*HC>tͮ*;ajz-fhŲZMlm-Žo}Yt1Y-2/|+5]l]] , ,)E*.qS\690iW|7 ٝn-rDe)VꧾlU\U\U9%TZ8UsW +yxDUmrU/q[LU[UpDZ˦-jbjb^**j͊V6* G ~XYWcW V*lUثb͊6*ثb͊6*ث*]\]\UrWUUceWmqKG1†4f[t[W p6(We;.«I\*Vثf# ^r*#*Y MmuȈ4HCl]S1ȥ\Sdb#y4X%nO}]x33b]vlUٱWf]vlUٱWf]vlUٱWf]vjWg6Bj|T~\L=?ȟ=26m\%j.v>1V4[k2G)҄U,&5u-2G]>]0GDE=U=qWE*jLPR!*kNDT튴F2®IC׮\2=;Ў\*qH]0kLU]]N;7;bc U|Y5\bԊ*c?8Uy+E1VqBq*c IP[v­xh +\\RI㊷hq*˶G,xeqWeIcb9 LUZ8U٩,F1C)1U⭌V.ʦ%f-)v56\p?ms䥯b}? CFlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'??ē'=<匐C6*͊]vlUٱCb͊6*ثbfZ]ٱWf]]٩]bXZ 6*rxYxZjbjbjbl*]\ثj`V0㩊N]1V+XZ9dbeeS ]1VWcbqb2q¸)ZN(*8b3< NiSQ[+Ss 9tV @⭶@4\9`\6ӎ*٩UUf|%7Jq*SBI؊mVЃB+ↁ;JmMYoeO\j@||$J#27PΥ1a]ɻqf2_~9uۻcR1ֻY9|K%I$oG[#P|YȕD8Z f®aɶ`qW)lU͗Rf\r*ڜU͕Z͊6*ثb͊/ (W*3`KPoL*3+h«͊Lإ®`WeP㕊 /+vlUu]`We͊++Y\7{!Wj0 iUm@K"_Qxtj %x4ϮBMb y#}&rLܣc&EM*ijG ߚ>Xѥ,i*dn;Q)$!OC-WDIr Jym\h|[ P6aW qKcp%p1«l [Å-i$p+yY8XثaWf]6*vX]0+G/k6*ʥpһ /uċ[SJ"?w$e2Ր!;dOy" szrG1H2I-4^GنykWw$3#"d^aAg*HQJ֙'Q\%F< R-2(SfS%TY;aޙ㘹N큍jcLsY3`fZXm;%,:(9UȥU[sS2JS2 \b銷\إLPrxu͊WeUPlU1U1Z9WW0]\ث lvlU͊ZV*+ .|sb9XU9Wf]vlUٱWf]vlUٱWf]vl*ٱW ثb͊6*1WeW sbf*f*f\10%E]Uv^(k6)uP]A LmVSEEr*+J%nBp+fpNa" QUF6daxǦ1)/m]4 L :QP>«b͊6*ثb͊6*ثb͊6*ثb͊6*E$nQ̼g0ٛy ``x'\R̠ⲿl2kUUؠVjv\2 Z5Zicn5ܟ\@/7XUj? k\rSCZ9:bc s**8Rk;⭌Wc]!K~]FmWb $u71֕-Mx |qVr5o/CD$1*;A-cTn6ɫxb)تܮq|*`r̎Up.8h㗮k35zaW Ey1PG 8UiPaV Wf'v5c@V1;51WU.,o]hlcG\v[ b95]6)vQ;⭌]EqWf)(cqێOa\߶O.TFlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'? ē'=< lU6*ثb͊vlUٱWf]6k/6*]LU51KSvjaVb8bfe6**lU1U*.lULULU1C]0Y@bUn*Ź[9c 8Wf8PP偊N]0+U\pUkxa81U偁+ ǁlzUM bgSQC⫉HV «[lv*JO*M3]Z#jUicW2\Z@& WC*[z;oW)_ EL ١ 4b#$)L|Rm*DR-(2w &"F tob?Y@Y^Lq g*y s-,1*vr9qHDjc}+g$m?amLPEMOLbCf#*1M" j&_0<6\kv k4-姌S_;*yin 8c"XRXnVq3bUb0*$Nc إngU3bbWf]vlUٱWe0Z 6*fZ͊aVb]*Y]V6l) Fl (u3Wu3bS6*͊2vl UXG6*ث`u®ͅ;͊[FVT+ d&7h?xSu%k*lkq5/gIEiqJ*kLgnC ^~(wZw1E\AxcJZ`Zr *MM>X"at؟lO僒ӌ6'/aᵥڿI wBңDbzeÍ*дQ`:4)fP~x^ۧۑWrBUTzqm:a+P4˪H `l/!%\tkJ[s~?!.+},ͮiCKKߓKq6~ϸN:]ɁrAxGS݂-<`r<)wZ-BRkd})US;jVb]vlUٱWf]vlUٱWf]vlUAhM=[/ͫ'$P?91B3ˀlw BqUZoGbr.iĄ\U8G-#2qB­̿ثXW\0V0+ z­e|UZ`WebTѰtvS)Lir2=diZV m.ц5  Yu*C\00!\,pz v'$fUkW%Whʊ5vhFU*(­c( UbW.®eRqV끋hqV_*`KXùlU08٘SI\3WlUer]va*SWevf8bƭqWc*cA*uN*N*uS& rVVA"3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'5<匐Y*V+NqVVvl ثb͊6*ثb e͊0Z9xbs`K^*XPLU Z˦*sSur銻51Wf]bv*6vl bfg, ULUSusblUh LUk, q9tV)j8Umrq0eqbInjUIULUM*/q9bu]!qNLI\`Ww*[vUcX>-ꮿ W(bf_jz{5}ߝ^-G#i|^Ip31gsSS\X(AcU6Lت˜aU9G?,W̭&^1028۶PU2\mNlUo+18!V1WS/u3Sv]qU7$^v^*͊9XUa4͊x*͊pU]\8yvn8j@mLUpusqռqWe0;(oiVhb? UREuiwJy{]fe$҅ʹ3c41V")h$!?2z?_S%޹2ƾ|ǧ$~ibCxn1Ϋ\ߘ:/2xyK HY܁ϒ}rE/*ʿS<>l3:}Ey6F*caG|lGgЙ{ؘ w%E?XRNGXLwTTl=QpLxq2ħzD}_^~9o(]7SNRb>2k`:2)F'`Jʼn [ux%a!.B. o QQ]*J_b_\ xOSE ccaSIXՇG/,J*!4 Om.+z?v?\CRCi4p.6V,=9ӿ6# Kط4?@~SUU.~n骼rW/|coFxR?+e\1v 1碘,&_`>~x/֣NY$U#4ۍ @LGTVV| 8]TWwVB(rv4leC`b]X G5 eQO|r1We#vfZuȫ CLHVZML +X$PQ*EnRi޿Ke3F) +&XC֜5 eߖukRL*aHE4W[v|0ά{u<{d*2ŔTt={G\2yj˒Zq( Ycx ]~ZԳpu8WFزw ֡#æwġmZ; ߮lPlUXp]]|p+XJᤴ^׮4MaZ68:jO CϨZ SߦMRUf4i|v֯%'ӄ7ڠÅ4+V}UeZ+\UMԔ% {[$)^٫voɬ>TFzuI2U9"Oj:)xKr]7dĄ?\4I?zI \/;uWĐ>ϾZt1x+kwx3O>4@/Vd f+oLѝN؜rj7Z# b;tVѷ$ @9V3J | rW_C- XJ{BO@:uʙd}w8b"ۄ4" zcV)ݗ<I + ـLhW6jLBAo-ݦ=uqH œAO:VJ9K-|]89Q\1>'9(ySd21-_ͶIN@6ŧ;*iQ&L1l>fHV(T6͌&ab f4$}5HknNGx/o X<֤$lH+Ǩ[%41"j;@aUs يWo|Im2Ih]iIk kiv& h^"-|@xcpuBCUIKҤӦ$NTW|A)l=~]2πvC`R|i ~Y=z׉7ۍOF6H20Ev1.4I%6Q6X+)^;u?,247TזT.vWu7~S?˙92eilb*7L\X?db~{tW#1ܝ;3 $ Æ*#y_RuYRu`}AE.$| raZ:G¢*(^j\)]$jƦc8J2M8'߃uho]gY {|N<?F*_1^C4S=t~V1O}Olׇ UFcI '+-oZ8sjQvT1x%78a/mH{r̤h|qV߉\SǏݐwNL^'6@QhUҼz.[Tvo{%y$뒌x $Lo (ؓ^Z>&\Sp 291H4Q'cE<$~/vX61$v-PT b|{v¶Uj*=-n;sm Wz';YۆftphciM*N5–MR҅?N-ir֎&@ ! 4%0~f_@^#P6gLNjGv'ꟙ\Ba8(IM3C_[J%j9Ww&͜vku +k ehэGdnjhGJd6@QrP@FW9-G ^cVN|0:-k$~k67Z4 fRWz1vΧ2+$x1%%6+ݺ^G:Nox]8y<@ir$ u$/d8 WP4@?*5 dnImg:"VL&-0z{H B:lxU~aWd"Ѷ^PRO]Ym3Ztؐl90»5h:RS*+TY.(W1aٽ+Z֚Ţ6Ol-MH5Wo| Yb+ ZMt܊SO*TpdAygVyEn|R_Ɵh\qX}OgpvPſ@ۈ_)u:*J[חpF 'Wr@ %P@iX4)Q H`Gh+tMPO*M~G9ߙ<{m< gOEl(d=fT$IJL jg 34LHۨ |M#.DNx REC-hF$crؑʭG1FK/FiV'⦽U!&H(@Sc7_$< o8VƑUU%Q[6(T\R6*ثb͊6*ثb͊6*į/7D_B|%OלgP@.eZrpK,Wb",SJͣ}5iVgbevX*dp̦_\Uv*vf -h'jpJS.HRhLP)+jt® Wve 'fS"P"a$Ɩ)nj'u1DVkL([\˅]\sm|UƘu U\UU &mwn0܆c ɢVeOJp7_I';l 9⿗"\Jא\JܜrfK0 ]Ӯe =Cn ͎ Z$zbGJdT1>lɦbREeӤڌܫ6.0mP_ j?ݷxL[-. 6Tm =Dm6QM-le#M'qS{bbz}5Ʋ7+kikr/ &w9 ;к,ē[,N0PsqJeZ3`V2Vpr]f*\qUqvZb|Wȡ[1'<ހI>-%?Z58)$txd>-Btq#1ÀKfYiY$S4KFb$Y=4v?lڗl, ZQJ|-d,/+޲.)WKI͹G"$*nbN?~swS7/('\cKphM0jNxV;\(vX83JxҵL(wL,, UY`b2鐦.)KFQUb|xUޥr«N<0pT  Ii]GLrp,yc#jlwN,N*ЙiS"+ZF;Ѧ)X.v(*\ i\J q­G|0-7%i5:7뛎Ii%OØ.~*ޝw&4N+M;z~8)s^9%7 Ɣjp-KWS50ũ|W, Vţ]÷ߑ Q{ vHeMyOzSAUQ9} …@5O*I-e|p3T#1f NhƇcƿ<cUh%Mm!r8B6hiˏTOͣ7HL) OH";u₃A'UbB /d&vzW1:rZ]ITgaI,G h[I:~좸ӶRLUձ U*9U6*lUٱWf]vlUٱWf]Jw?dZKuy5$~?9#vb4ȵ_&1(vZ qʘRq*:27Z88XM;byثXCZT(]FD,5Fƕ]\iS [8F]oUQ0`0]&""z *q=a H ̩c[. S$;Q()v:U@Cm*zlUnbWfߠ\һb8$S-h68kRLUh].+ik[8* W0lR창𫲸Q]Mi\PP \r =qޘ 0!T0b**m\U*L qܱV⭁UlckP6MrYʐ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'6['C,d2*]vlUن*ث* 6vjbqCWeR챊/;6)ZrV6*p \N`1UF)o2˦*k\ ^)v]1V0lPj`Ku *\UPX eV1KU]\Ub81U㩊/-9`bI+IN^*GbcU1Z9xܣ U(\$i \U`V*Fj5§,*ILRkP.UqOlܨiWX\UanBZ!AGԲd-"~Ґ~쉎ꅚ% a: N Ԟ^TsQCfrQ;oMSV @ XQ@9Y%&ˏ/jվdW`cܶ>Tӓa3\iN\+hk#ҊLlijSԹKɘ,WSv~fl2˖+0|HoHڿN='X59VW*>9n cR.}H"n]85KQ<0ET|)Spj!SMb8$w$$@~<ͮB;_V{ =ğVy@(8}S>ЄIp[8XVZ;G}3F?ӷ9`dV+MNm"lX`C1KX~ <`5UW0]p%C Z8VòkM/#+>[2hSBpإ #tMkO: C;Qǖ2*J.<+ޭ5a~O?!ˡc)65l{u'%\eyBPai%in7'ZҴWc|rQ+[#qZtȘ*9u4ĊV@=rEZMkFE[P$UPAƘ‡f\ ZN8&IZ/㆕LɗƸLpXez8L͎ Kh\V*U뚘)[8c1\m\f1Zתh\#o>d.- cX?lR;n ~-1_|VY |O׶E n#oD *יA(ƣ3c *`jqD$*1U`\Fo# f li~8oK)EF+j6?MqE|ҭ_h9ڟ[B6͢ʛG)4Im0PJ9sVM.~W6*[?,ؐ*qqCv܌U1jh}xf0xaw+(Êgm*yN^.c^s[cHlOc#[z| ㊶$\ҸR8`BsSn—W( S5)u=+. hNU1 lcHĪL i 2*~.*,5nClC՟G@>@d GK[kԼa(d䌊dU&0J.78FȥUbQ]vlUٱWf]vlUٱWVG(nDy0kNH']2 HqV1USZFVhZF8NF o 45)CXo\&&A!|mWjOyqɔ1 ٻ`lSMd.~v*><'CQɕ3nb:IƕUw,a/Z +#97q iZ]SČm 둥G,SƚvL2HU8,*jr[N`^ 9yB]qXҸZ iW c ƌl*s.dU]F`diQtͅZ+qV 50+c1Uʦ*]ƹkV*f8BlتإXAV0[͊6*]6.Ul /fxqJᕊcc(W r*4VͅW]ncXRqFԂ Dhzd?Z՝4xEܹ3ep}l*,~~ӥr`|!x1&~mc Yn4BcMG=<9n H9?Sbai|j'~L}rZɼrT-"aA._(_Q~8(DCI$H&֣d 'w@R=ltk"鰚ūJ)omm!0UC5 4q+83nhoUF'R ]tڸWЃU\IBg+ V9%n⮮S.lc p*fs6֘ $)\BM/FHY&nCjYܡ^>#vUsb6-6tVY<'0TMqJ.6ƜUUƜUpWf]vlUٱWf]V90O??՜ͱof)?oMi\(0iN]Ol6ʸXivUk\s)npbN qU-iZluZ*q*#*Sv9qWe2JUKJaVvZ861)]vR(aSkJv.8.qBqNثx4®68TL c;Ft\U`z UTobcyPqWWfbhl*qn+@F)[یU qU_)Zs0&®'k.NnXv Z(lOZ`*;㩁['0*ZUFv_WWLU4{bʦ;/ ]plPS b\ c]*Db]-4۟5K؟O&TNlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7? ē%6k4F(\1]vlUٱWeUӊ0]vlUٱKbv^*챊/hG/k,bv UpUF(urZjb^)v^*U0G/"e)vaN8 Ur—f!1CGbثDR9xӗZ8UkcÖ0*#us UL*8ኴrV)Zʮ*m/so<18+Zª\b;8 n܆jr ,ccnq#|UdѪJ;Lw 0*k®\5*ak㊪+q-Z*sVoՇ/BnZՒxjWf1c$O8V̹uqBeU3W[LqVaUeZFa5XsP F<4v4E}n`ܡ4W(JVJO};t$|Q_fb YqGOdƘ#>b&j?2.$ضmSiWer$uo!SOgm;I>ŖA6grA KiGya!*R~ G\wnZ6 ^N&0R~mߌ1SLSRR>˦Fj5f4\cJqi\n3SW 땆p.lw,U".٫f*dˮoʮ*|īW.[͊FcVa/pQ|)Z3b.l­ Z͊qWfK`bUPf+c0c[XᗁW UFkVWx9)o+\5+l[9Ӯr]φ) 5l"J,I0⣰3[O: Kܞ߲G2EZޅQgG4 syD3{ڭݳ{G i4/HX=!jeŬd*}8y!G"ʟ`@:W* x\4[5xP3jZrҞ-M)9\1Ǭex\^t뇅k=F D1CJx3嘾Bd&;ThDfGQ5έG@)ŋ囩y^CرN;Q98U偊,UiXKdPݘ8o[ 3!/|hl@EQJLPN)\*uWw,[6*urhp l4ZJEd(䒢Mq-8C[c(vTlOLUl]T4Qw0\)~LI5=*4>߅m$o〚GY>&+[s0ڮrͭ +#<@?"LrT *±֦>ӪY#=?׃/ FN @xOsӐ@>.pf`1x rRyǦ@!hF~%a`s-S윐(;Y:C0"T|5_FLJpQ0 S1Ў'tz|kwQ-~b1쿎>*a]圚Dzc'.6hHI?➓ڧр^H0O21O l >)MUkjljk+k65c/#|PU]HOC㍥ oL?oi2'!O_[(dBj9W7ě6MTNt+OAnO6娮ISl*9Ap+[(®9[ǖLRĞ>_*Ilek\rǀZtleUFvjv_تY EPx\ X M9#b># >YR Dr"[Y]r <:e\(R)\Ui\ثEr늬+F]qUf#]Uf«V1UeXF`qUˮ*SZİ*0TvS"q5@h# O mqg(tgĔ]yQ618k}9-1ˉ(˚Fzܐ0+kX ǖ9R?0:{R YS\og)G98V_0Q [Ko0 Čhl HAlhw9ث:W50*3ttUY9U0ZjcjLi|*L3r)\ ;eZ[TBH\ ͆٫*3`Uݳ*Vh ثnWS/kpiYWf W U%vl YWS+ *ᗑV늷S eb͊+]6^3b͊폎vJ$WUl, <;1b^2vs#yb)h^`d!<P_|K/\4! ~Olpj#sj1wպG!$?2?k元̚YmtÚѧErGnMB25yL#Gu9 Vɀ2Y' +…յ+}6?R!yl^F|b}aa'Xj1\Ƴj+In܇Q$p w /pŒXC/]Z+5jUl$UOĽr銭#6(ZFjaWS5)+YXD`MY%NC|'2B_NYE;mG#QW`ųZ *|l7qVAƕkK^Glj"vĚaT4f()> K;4ץ`t XT\Rw6qQɼLo愜Hń*],FkzefJ/4nɢ[(k2To>r!v?xT,SpqYuPoLLplR;Lߣ-cPR2Gێ1W?O1k-Pjo' C',u+*h``J`WfŊUY%k6*⮦j⮦lUث+ ]LV͊L`WS,b5p*ثUqCLi ,mf8,aWP.jbҙxMqWfvj]u+N*9]p`f* [;f)jb\X`e\PԠ` S7Q\vI]Jmv;#bs5cy\r~xA(yD#l&0Gl$Kd;l P(H|VW5UAۑ4>m+WlYٍO{:J;l)W"8lG8##8U4⪫UlUثb͊6*ثLǿ &uuqr4#5]#emOXc&\IE,.g|8rxZnBIϒl4 a:M>{f, Q]GOŌQv"t>{u{q[{f4Cy+һ=0*rlv9"(3WWzfZisaU\ Cb23`*r *hF<BLUڸ |sS W(Ue**t˦u2T͊xGpiYVbfW UṕW l ;eaWeaWf/\qVUi®0*9GT*s`U(Za 9 ͹t \=)4=2"$ORQqwLA{q(sc]8A-/#zx5w/"j2$l:sY4O4ڠܧopE+V@hGQNvH AR;}h26 oe3N1>'^oE0/Amq_&Od9 ;s `K,#%1}̳Oqu8$|) 򝈵URY`ͭ_H8i0$!8 ZF^*V0\X▲JO  4cpwa[5v9GGynEԌ%*))M*W(dvǂ*X*/lUH lUia )?F(#w蘡 sZD*ҏ2&kn87G$v~Uag"^gn:+k$Q}1Efu.HTT-е~\[ⱍ H dJV(ʧl@>@v$|\TALnKd:.6U¹ V:(╥rJ{)[L*ءnlUY%j+tLPf8Y0*ebWo5qWf' *usWw6*lUcW>+|[b0ɕU+\Ul=c[XUٱWfP2j*\JU­nU[] Z\Pz([Jf-횸UoS+\l~*E+Vh'4 [4n?W$zG"}#}LI^7Y]6JF* ;o*0qf w0(@p .[FWC!?A\Q@TOoWr!q ϚUEg?_Z` o m=cHĒ|+V¬»k8 i<侬.PFN`!F~&idD NZ(c02DA\k`B2# g| FrE(ƜUUrJ͊vlUٱWf]u3_+ sy>c ٶ O7;}G*HɱM+qCzuUٙ8L7msaWf–銻1Z⭌cGQ2h{`CZ6ɬFUu*2%G;3mlc$$n0oZ=q\U"b4oـ­b*WG|UcXʼqK|RX;bWLPk3t]K)qX8Y*yU=U1 WfQ\UjqVLh Wd0O-FK1< L? ULsr y|U3W 늭1X*cUa08X8a.§\UiLX™VJfhX8iLZ)\Uo J*]pErxwrG*GRkꢰ=igx s&K0Xvʼn<|0kRW\Ė)ݬ~znǦQ'", Pκw=R@cʈ! q1'*j3 JAU%v͊r=+lUpc_RzSUP73tƕY+뇒MrT1VxU]vQ«o V­ثYWf]6./嗁-;nTL*2UٱVˮ\3SoLU*+͊+ [6EW\*&Q89⮦Xw闹[V G#4aH%I(~Ǩ +;]RsE9?(43ڏZ0j)훼izZdfm~9!dX# {6q^*בWv5wbV+ȟ:E"U@d~ײ8(`T3`BÏ9xP*(VZJ*=mo?ވվc*n4I08~@d= L"ZTb>釉SX>B)$1jA TMZcX宍l2K]Ve,Wqt?g" 좞q> Lj5cV%ˮ*9X x\ت2lU3bVao7,i]Vst]C]hX' -\NlPש횧KWz?@'l=+T-iF]:ciQc19eccN}lvZ_*cDdReTL0Gߍϣn>jrؕ@q Je*exvh?kߍ1yJFcܒ~X-i(:}b1ӗ݃xQ~[]ca`qO 5?-rK(ș'!۲ ^D6ì~:)E+$VFbzVvPFk2(P~xR^jSe]6ՠ 8j xA.m7s%\-m+]HI*mg v7O]_a^)?,}̏ Qڮ%CIm(O͸z ԷxPs#ET5'ikG'8P 9ks~-)?/W 2ߏM/ (d>x-!H 8?cr[-4-[7ۮ;"aav9 [?l ?~u:'ƽYikMj{AiŲrED-6u}U:|:}>>"GQ[>OpqeT|*)쥼ɤi> chECX15g'bGE?@{H+X*[vӦU?ՐoO[d~l[XmYWG iY[n?K)F)D=Ʊȩ(t`J*9Er*+|تثb͊6*ث`WBOI o5Wlc?$?#+ei])* i\6Do*ei1]7]v銶14p]a rAh08r'o1')hp8U/vb)LU:kj8m*MqCUG*9MLp@p!{ –PA\*2⫲WcV8®Uj}+qqV|Wf5] *1F*Puk57)SNXA+Jv«q–?*D+U­a\*V4+1WLlgl vbh‡e`Ki-זu08_-6!.I-Od)`͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'6['GX2*6*lUٱWf]vl*ثb͊,`V^*RU٩\bWeUpNX+NlUchWefvlUxYyV 챊t pD㩊'+4qإU1VLpV/\ثU͊\[4㊭'1U9*9aWq`CEi1LQ`+~_QOZᐟ&ȱ?}AE*9 ?舣\m(Nejc 1eSh fuVˮ*]qU3Wk`qVehX8™uV\UaL«JX:`%Z j2J׊72k> ;T%ՔS LpEpI'q֧0@}_۟igw9לdS5b #sD} @PvĂ،pܠh\7 ‡*5.G(WYD늪W%sW 1Uǎ^ UJwS\ܱpYcJcJ>nX)]7,Ur(n+aW*m ͊6*ثWeBr-͊]́[6leaWf[/u[⫗lإQr!Pf*R l*jbsLUi|!V4tQdBUw$<r{d%ֹd:wdžkPe!۠;xd_6o:qF%Zv'f?͛$dk2.EHazƛ+)F,kcNzԒk\xTIxEZ+NlBÕV¸J#AƐ+b"ҸqKAJ-w4(a7R;\y+a)qi~6i핍?FY bF;fWZb'Xc5qU|*ث`*cj؍@sTcj؉쟻( M*;'9_Z/1eo!+Li~*27ӉJ!ckHF7ӛ~'q'*~?NX?RA8>+{1FL~iiM4T - ҺD1`bƽi|R͊ͅ]QúmoZ6+m]Sw?l4Ͷ4rjƹ+91VYX`lUlUԦ5N+K$oDV |4Y ^5' s)ⴰ伕 CE)MLZ%)N_”y3NV#R}TO/ؠBc]JzZU]"zDw&+%H8=W# *Vz`f@3WWe'P+N*Qii3 w'-6 zƖ(}/3}m[(،s(ZS:-u> JP)Z낑H9d^ ?ezPᵥlj(*FvTq2BK»;~31?F̌mi qg{l~8V9I~=7|$¨~N?؜Ozp%ӒMȥlzHֆ@+٘"Ðʷp~UT>pe'bӛ]Qo6*sb]Lզ:6$ G'?9ǝԵ6ld m(IW)ᖵZ\tZUkz[DW(q-.qWcWvP8H2U ׮*;]1Wc4rqWeF*tORU\EqWf|Uɾ*lcT[Ǩ 'LUq8c*50!z}@dPU0Z'zb )LPc0+qWSr1V`1V\16eWqs*:銭]q%mq 1KuGq z,®еuPQ㍫ޢUq 3xb7—Wn 9(k7o]JUt(vlUوw0iMr䫗Ef]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'6['#,d^gp땊h®0+lUh®L UٱWf]v^)k,bP^*hhk,b*]\rUiZ͊]o51V^*sSlءrVaVlP^)vX-eUpc rV*́\N8aUNءfi`WXN< RW5\;b'1JsU˘T U4QQW2cçLbqVx ƁLUReLU(-qK|| ;ơbwMCfQQ\$52N̊/Lw z⭎ኵ2 RE<'SW)S0\i\8i;L'&Qcuȁfy$5qrC^V\R(sbJeJeW 4y|a,6*śXaVNjf6(Za8UcC)',6*c MnXXlUa7,UjzyuVbJeZS08˜<6,*X8Ҹp*.X8t]{aZKէ#ib}SVNH.>4M3`,jM#RћK P2 Ӎ+1x6lH 9Y L^q0?#8/q(J•?KN,?(T9|p\y*U&Q\U]l`UWeUثyV*$ܱ9%aVb͊6(le"f+fe뚸sbSjX`⫁F\MrUiJbٰ*lW͊ιD`UE͊m͊-헊Bj1 2PSƙjwA,kXV pApiA@ }l0` MR1mJ A$\DPYYA>]r:ijoƧ73"P/)pHȥpӚaʦIV*b1K;6*ثb͊[*Lp_զo啎\0HnrO݅WorQ$*Z_ _>8 R. SFJ)?obFGi1O&޸Ƹcpq'4eVֵb۰ļ)Sؑ4b21Ӄ4[N cWkX"qZGCCSM!ȥMcGu늢SFc\R%1Tbbsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثTj=UOюWuTĆzHPFj%b^P6 INoW+}%[ma~Ur讦oTnOU 'ޝ+Wªqʎծ1J|Ur:7cH]sO8èxȧn U9>품[CDv Yμoυ;ٳ6{5ql1W7XU٪F#mv>XZ9c pu(qjb̪@]G|nD]Ls`WcpW Z86[K\Uli4O\*ZrA;3Lw]\QN5\}1U~UxʦMc*k/|U儮* GQ\k! 9 0+;*NJb9Nث@bj⫫*889,UiǐFheaWbnbN@aV\mWWlw 1튴r*8 1[n⮮QQ[`Wve]Vo9k)I=qVnnO*v*oZ8]/\F\rxOvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'6'C,dLqW ثy*ͅ]`We8Wf]vX]vlR챊 UٱKZ8 *8 Uӕ\Uv^k6)va/4rVV뗊Us UXr]\([R,bqKG.Y*u0+G, Uc (YZ/\1V-b',ilLm +9;eW(qI#CV>dUYFbU딞v<1UPp6mZm !^֘ޟ,!!V z*WFM7뉩_Ow˥zbc\Uy(|Uʪ|'kبsL%c#~}B|E$MCu~t8s?9.PBDƃbyV)ZS/ 1U2WlUi7,*ŗ\P*Sh…&\*{eT^`,ⅆl*lPʮͅ[͊vl*͊jUY fo]pR[sWU`U僊C⭖«fTW+צlU$6* mQ{{cHQoOd$2\,1ナVLAq'kM{ `O c Yݻ}?ѐnȼ^0UXalļO\(R'6([,RS^UL僊pӚ\N_,*2r(j.Fc*t(⫽6?ʨ֗d2Ӷ M+ǧH֓>x"b$of iWQZE囖0fQH>,D;@x?}R:o^AW*:[ڑ193Mg`vWɨJ=I寕4qƬU? ԓi2cz`ZVu LU͊Tb3`V͊LUͶ*Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb ثy!vlRfu3aV͊Qkl Q޿Fcl |hbGӍq(Œ~A3Dw[TI}ԼmA {yM$^?*R/Teŋ~)4e&X5KF1z5? s]XK)' ǐVǜKҿ.34ZEtEl\y~ȜNd ^gM>Vz089tڸUlUö*jaS63s\\V=1<$ثhت2W͊1f[/;V*]qK\2Yªm86(QhaUX8PeXeªf,ܱU,ⅆ8A^0!T 튺6*ثٱWfF*rLUWKp!cLUه\U.X튴1qWI].,RqV̇1Vnj`CjbBC87•I8;(q8*9xRi.P\NX\hj*,#M5K>Ր (ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/?ē'=< )*͊1Z]SvXZ9Wepʦ* 㘌UثVX®lU9xUsS4NXZ˦*XYWef8b1CYx銵\.ˮ*lULP]0%®^(qrvl(h匊VaVk*偊'Uab8 Ui4 IL®0;qZ [O|Z,7)5{UŏEƱ\+A\Ǯk,1K8^2rڸs'6n*߬6-XҘ|G3n0+1'q!p<JJƏ.)l1ݱKu;e.F15=qPLMF!bmcIrDr]Fn3 2R5nAIOk*_lnٱWf]jV͊.U9Up+\rbq\Ui,aUryV…6.GU y`Ly` ya]qBƏ.UIWQh LqU&Lp8&X88Pˎ僊T=B)=vLJP읈ǫM6yVXTa,TnQ< I>Vc@J8:F0'T[㬑qS,C`6ʴ9Z_QY)zPf3TJ)"MrCebR7 Upm:銪+uȪ( Up,WV/ +|M!c88Ҷ29 LuFuS!S#N m-T6*sblUٱWflUp9*,JiWҮUpe18S4 %m*[Ujj: tZal5:ǒ[{eYdR=t/b+ar&y$kmq#|aL&0Zi8vWisoY>} k(ԁ#P{ RFja:5qWon+]b|8NVl®͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث|+雾*7|UH;tǤ )Q%EaMJe_) tVpՠŎÍab, )[7ds\Ɵr=HG*\ʼMkO7?~RХj{fdf$Ҵj+ՠهc9;B?PnqVLrɊp)^kw\UX&P`W _,P|v&VlU8a vR ]*Yߦ*Sk5`゚bf]aثy`-ȥ0+.0!+ \ip6'|UنRb)(t®p%٪1VbJ]\v8f®ʮ*촧|v8k/n]}V*sQLVӮ\`VTmJwZbpVءx+$WlSV 8}p%U[lf]  Cc5v[0mB\>ՐQyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'=<,XyV^*UٱWf0YxblU]\]\1Uhur*XZ–eZ9x*9xU͊tZLPU)qZ9CDKUR↉ʮ(k6)vXˮ)vlUf\r*0!9db4q늩\UkcU618Um+ƛP lv*印*ᚕjZm& m=qV\ʨ]+IB١Co ȕ\ڙ *H 1U}߮Po8n**;ⱝqU ӈ=i\|i% 3Q{`C)Up%q«NZT21P"7'SCiJ}J 3U" ,Vܒ~y.Xu~HF7UA6*lUٱWf]vlUf]LثT͊*\UUrV,dªe3VM\*]qU2늭)Ua,Pǖ*㫅T2b'Lpǎ)4g*b/X8ǎRhL`U#1Cc7\ x*8ңe{v]7튵L1KM]x*pX*s'hm;`U٨p+S›w\7qV.9chhe+LUc1Ve$-ذoV1Ͷ* s R쭎,\3q[JbeU+`CuRFhLPƟlUt]Q@N*W^Ul-qO%W)}? 9Rb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē%5tE}Cr?ZDtg-y'YHHz |uxH'v3b4:׃ʼV,'iw˩ +X#TUB^Uثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثȃ`C{׮bR-ZbchJkV!Жt?>Aq f?"ʹ_0wԧDLMtja^8mKnqb(7lUӘ-v][cN8d 6*0q<+aWW.5-U19`Buqv*`p5Za\UOUT ,Ujm4nqUٻk-LU\Ucw uWe_*㗊|U*n=VN18m Xn٫ZͶ*٘bf89qUe8^1We|Uم1VS6W.TGmW7\/\F\>՜*T^lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē%5<M=ԓRG^";M> 0IbTPBZb]C6Wal QnxUwlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٰ+a)LRFl+5H C^k!|k~U.L䏿ų+nChh9x.D.Z<⹛[!LNCbraA\1|p(#Zr*<8`V WN[ )uqpr UF(h'f6f0O;5Ρo"tıbsO퓄j+]vlUٱWf]vlUٱWf]vlUٱWf]jWS6*͊Fa]qV͊+0öc|P6*lpI,berV0UL^*)2(QuTYr qU\}qU qUJcª.ከu)*,xlUA /_,UE)ӊH7!5CC ڔ:pqQv:>4Iy~ks6%qPsx[Lt;_Exƫ1e[0eLHL67omS lpȪ˷\*pFQ9418)V>t$`Dv\'[WFC9B\N UC"0tLzcTPdR̫S,N *Wǭʡlتؑ8ڥycŢ`>PyV5 ӌmdqU#jWQW\yMOO"F'HϾ]~aF[x{GkGGQi$Ӆ{B@PSa%6V5̨lI'J!rIc"-gQ|1>)U)Wp6k6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊1ӪF$wHjeqH$pSN61.LnP0=pP#)L`v«NZc8DeHp')Ҙ`W0m銸u1~EM0+5kL*rF*q8u#uqv7NثuN=qU)dž\2 U=0+ a$Uv:Wf[aF[ Lўo1}b <1VU* tYb͊iqV6\2qh*WS.Wc/lUWvǖ8јW5kMWc*Fn ]?e[_SYϲFf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'56*͊6*ثb͊6*ثb͊6*ثblU͊6*ثG6*3blUf«H22USa«fVUMX L2…WRa0A>:UAR#Q+Lx88UE\UI 46@:m->rPu¶PD~/{,I ?{až С?ٯIe bWqrC+fOTnz\b)@'OITl2AP3S$4|rPrܠqOL\P:jFjF ;=~\%muɟhsL >~'W.dVmծw-?Ζ[]Vq/\i`p|v~dI޶{S/n#h1t?vJk,O}ǚ >閌1ko!iz OK7N[Am5ѭ- /߈3뒴"[`\lwVCQ7ӆ}tJֽ3SZF3aUGQvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUxv[[)}ڏNl'Mrh\irReaÔi-S\/zS&_dAO|Pm;oz )!2}l1VcInuʌ늺;{Ui]j1WWA]\+[mV\cZN9p+d卷8Ӎ!r햣j 9lUhLUvWVV*ZbeGLUDoƇLvlLUv]1VU,vgt\9almZ^@ 29XUwJU]E*8+tb|qK~Ǿf>ء^"x[1.?#%mSYϲFf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7? ē%5Q%[lcfװce3aCSlRI1W| #5=rMqUкEVcQUI"b| Z:ebCT lqU& )LP&3CWJO5;y|՜"=)lnN`,̑ԨXӊUGLثyWf]vlUٱWf]vlUٱWfZ͊WW+usb^*Z'6*DⅤV+ 1BØaU LrUo M0Iت¥FCEت*1U`L1 bNb.تG yaU` h)}?RR##9@"E,iQRE#*ImDbڎ;qKw_0i,o2*FW 'ź'/#.bymmey x }מ$bS 0Qi}FJ<S?Rtpt[O|>R='b~ye*gQvc:dUYˮ(jXUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUن6 L)t8ԕٲy,% MmjKTPb$NlDq%f:](*A\2Mh͜Pl2ڇ\m.S\c;Pr X⭶F**̈́2J-r=AAoURH4ip(:f$BǎS/K@E@1VO@8|i49S w—W(:bk'1Z qUnj{f urn(;`V v;WrIbuYEV]ULU'ur*YAv^F*+k-|UlU8bqVLU08U­ RN \~*U1We )vl,vc8aˊ\+k}? R3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/? ē'.['Yc4P땊*^*`V UJ▎XD«N]1KS',bbZ',bW.Shu1V1WW/hbY\UҘ\RU1VS\Uu.ʮ*ءٰ%c s`CY-k.DqUaGʘ3bS7lUͅ-ʦqlxM=N(*L1(XF_]UrtZnqUaU#RknjPb"( jFQm*Qt<,hF^.c㊡N7]*dW*r+ĄfzA T7NZT h1];taQQkU`5&0l]`p ȌQWolP4IƲ;b_$:'oٛ<΋^E?J BLثEb嗊f*aLUo7X Z(XS7Nت_/|ЌVPoXت8C58 <9u,hq[.-1W ̼+-@DcL+lRA0 ; AQns%AJBE60cLURlhiKF=33|%@ 厹ȋe VX^͊^hn8P,p+\醕Y+eSJS/ +L`C~͊c6*c6 KQҷ һƕޠͶ43cJc6Wr9x)V=U+[6S/]bc'/$2 3v UMX$)1qª.OA*cmЅ5$(bO߃-!UC }Q3 Xo$mGo4S##Ƽ*څ؉)[׶`l>N'[ )k#weHOխn%f Q MVw_낕;򕅵)s֮i]bOӆ4E#E_UF•'ujbsb'0+\Fl*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfZ͊\V\Uثk6*ث vl lUf[͊vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱVk51Wf*r]\Wr͊Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثblUٱVvlU͊Vb͊WW6*ثb͊5qV뚸usblUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbׯኻN ;t_NPO^(ʑ!m,&uM@dz%'3Ps2%s2x[#`3!>rqM7!ߎ*6)gC)Ǧ Wc9%o-Z )k/>8fTU8~U]Lö(u1XちZ;;+nثT*f Uq+\Uv:h1WW0^uqb8U٩A5+]8UܲS| kZǜUM튮+sR*.qWS(LuqV Ubbc,b8Pc04]L*ثbeR[2F\FH\ާeJ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7? ē'.['Yc4lPr*/k/hZ R-V^*Z8n8b/vXDs 졅]2*s UVW m0S 6o, R9إmr[u1jثT‡W50+[lUh p+Yhk/ṕZlvSZaWW.X1UN8bV1mrءi[M_J psSj*| t+UoU4X҇ HYtFGvș%y hD8NCM(>u0.%'0ocJiCݚ]VMN?ԟy6mVk/_TEi5E;;7S\Hx뇒0yFúW_ucV%?5_727WoiQ鶨>F4UeAJS+劶HnW ثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱVblUreq[^*9cju͊\ٱWf®͊3`Wf[Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثG0ef]vVWW6*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Z'6*lULUurVb]\ثLULULP]\blU͊تثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*sLUկz dЬc'%ZKyD1Vg? %;SNÉ(S<0m'p~|"P+M뗵J`R 8,- >#4iX⩦8N%5{1D~?N uA/{$dq/6Q֠QEҪ5Z|ua1UUWyXf?ɭjL-|g,3_P"rT_(~jbM;V'Jj>J1U)]ʽ ثYWlثb6usb5pb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6vlUٰثbW6*b/k6*UثyWeb͊/nWLثlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثU͊WfZ', ثbf]K_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]hثusb͊vlU[͊6*sblU͊[6*j\ثxbWf®͊6k6*U*yVW6*aWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]u3b͊6*ثb͊6*ԯ\U.p6#uj(cT8ʐEKKJ&dz%U|Fg .$LB^| i'@eA OJyqV*12wqCtmL{b1j U5\U٨i*xLU危CY@lR㊺(he;b-IvewZ1CN)n§ 05kk`ثv\2* H\qt qNV4-o5w]>8u]bN?p#׶*1}U͊1V늻(beqCRt*ㅾd]F\tާeHF]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7? ē'6[',f[^ClCYc[1VZ'LRsN< [­ZrVlPP R͊lUክ9-W/vQ )uqrU16˅[ xR3lUs *UnY8`+\wUn`]vjb(hl kQUզ;p*Yql\1bmV*1bfk P6q9`▎c|U#,u \eV05Ȧ:Zg&F«#jFɪ U8C| 3}\Ru\A8AeYA {V ih)sQ@=p*%zf4pjǑS^PP{t5UVF*"+Sf PHZ[lͱa>aؽ3 dLP[BWnU1P>CZªlUƇ\)]͊ AZ[\ثT6*sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ت9Wq͊WS6*3blU͊WS6*f]vlUٱWf®͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*jb#6*f*f]Lثo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*lUkULb0+\b͊w, 8\er˦*]0X٩]\qV\Ú- Up9kW\UܳbnX]1Wr]6nV+yXUX`P–f\jVo6vlUٰb͊6*ثb͊6*ثb͊6*ثWvUqUxlUٱVb]vlUٱWfCNn0"ͅ-v`=GK2 !h:M1H[M;.' q4f=Rjh˱ّ&$RbHw4+EHW1Z1U)cN1Cu+ኺF*fLUVZC*{KyaWSL 8y]1WcLU`튺L6.Se\r\튷L#vc`w˥qCL#*^8r]0+튻, Rث)v_-VLUW_\F\tާeLQWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7?? ē%. _TLUP81Jqhu0+DRLhZ͒WepVVS4N_Umsb pqyx|KN*챊m]Pr]\]\UZZRrmza\U\1UDbjc"3ZexqUf#usN^-9c8Rl)h㩊Xub7LVKZe WdfV\E1V?T\-|*p.9銭AU*S)*lUŷ=v늭#Y{uc]2|UtAb 71UPz{U\USѧ\wlUOn=*Sn B(mJtlU|QԚG33lXvT?,X nE151BsSNj⮮X81U7\ )A8Ҵ)10*^ĽN-+vIb*VؠTŽ [eoxiLzxh}YHWZi1%No-.5C$#J4'XYaܒ^ff$rV"X e *ڹu®;f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱVu3b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfZlU͊WW6*[͊NlUi9xUM0 +*Ԧ*͍+ +^P] w®l jm /Z_6*]0+|b­Ve "ʥqVL*rKuLPr[lU]\ثlUurRlUyXu͊vlU]\ثo6*ثb͊6*ثU͊WW6*lUٱWf]h*f]Lثo6*ثb͊6*ثb͊fZs]ΖX@(2ʚ2E1L -W9 <6͌8FՊm Z+LwQ8޻b!aڸRgƺ\A[vX4.9YqV ↲SvWj`Vʥ1W8YXU1VW 6*UٶlU)*7-st*Չ8dWW+*ebvv1:`UqU6*2*])vbqWe22Mr2䥸Og<ʘb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?'aodԿ [JUٰ+X0XV1Vna-ePcFjba[v8b^'/tBRe*1—S( ⫆Q]LPq|Ui8)V"uk,o W.RLV`Uol)o7*m["|Umi S/ZMqb3`V# Za*c q9B޹`ʙ%ծuXze*Dh\UBGpڹ\U11U@l k]50R0JI %xlf[ʦ\[͊\ثu-51V땊2Wo51lfث`*fw*e`Wt]6*sblU͊Wu͊WثYVlUثYWW6*ثusb]vlUٱVb]vlUٱWLثT޸ɠYqU`GߒQ-]Cr7s0hRU5*}}k a^\I,eց_l*AJ-tZ,F,PtM(8׬~ )7LlPec犵\Lr]vvƕ1WW,]qWWE1WW0®bq.^*m!L*1W 1VX▆ZnLثC*v1WnZCur銴r늻;3bfUZc7LU |5˒G}?9TnlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?'aodԿ [\8aUZ81KD IhbbePLPRr\N;jcXNlU4r(j] `KUp*쳊(vX'ZUʦ*9`b]\mpԮ(uq+-W(8xѾIWs U29gZt ˅-<-r(S',aKUʦ*9xGUN^*:c(S&/h޹xD僊Ks║*9}04ʘЋW*⭘j`Ub嚘|[UҪs;*t4p΋ [IOWOI|7vo!JB)\ v b|@*!,(TS$+Jljw )o3%1Kb|RsqWWӱż>b4\U)*bG|Uu®0Ӂ\îvf4]V(v]1We.6*Uc]Pm)/ /rb\UceeWh#8 .8[Q.?#.H]RWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?'aod!5? Y\b*تr*81V*:0!i8S \إiL saCDfڭ"dCXq9}0+TS\RdP▉ kJt@+TٲK@ )\U0(51V+B+SLU2…ܱbIqWW08ZEqCeʸi9kCG 9tZjb,\1dq8m1ˊ\Ƙ0J9T88…0nr˨|UHI2b1W&銴wwX+ZWFnU\}p7ƶd/\ǥ1WmZN\9qJ b"\n4qUY4UcGnRp*XR^(h]++^W1V\l*>U0*&jb*&j`UWʦ)\*WLR6l\0f#p9TWW6)l1V銮]qus`V뗊\UJJbXu͊WW1-Uo6**U1V͊,blP8Tو[T]6*9Vb͊6*ثb͊6*vȕqZ~xSh~g%56iŅc=@$s09U3+#;\||0ǿ^4ō7* 7ኵe[ ~ثUǃLRe1]L ʩ7@=0|Uن8ӹF*bJo0jUى®-78yxur)vV*\(o, UٸVnWW6*ˮ*|URW9|qWo*b,(q?k$SvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG'aod(MS9ІX*F*9*Z- .bV_Y\UZPr:@Wv8 Ui8T\q8@VL\)is aKm;[|ءrxfa\*-A,iWg v68ZFUibf\\vqK=p!c flUCl*6*2(hXbX4V*Xk0­ mU" S(VQU(B*6ƽ{ W,*1kSf5=U*N2T+ c)>lS*٠ǵ: UIw8S^[-W1L LQ[cQB9$"nH4yXJT%O@rCml 'sS'txܮ?1be,ElD`UEȪJƜRVlm%UzeW1UÉWWf[l 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*إiLUYtP51WzTzt«K*|brLPYxrKE `7 W,DbeF JW˦*|V3TuªEʦ*R`J=rbS\51ViTi Nra( Vzˠ+L*zeKV ͊d*ѓ, PҘYcXϘSi3TU皘ʦ*3V51Wz*3 1ߩo#%zύ+Tf+S*T-˦ U@TęWʦ)^+ ) ͊WT .6*T]\U[j\U*ثyS XyVf[lUثhbe;6jsb'+usbo6*lU\3b]vlUٱR3uCgqLH^c^n>@yKX?nKSt=3إus4--s:⫈nQ P i`1C`c-W05Zb+\A7 %̸PV f`CyjqWfuO UOUٰY*P\NYfF*oL*1Cxኸ'+v^*]U2ZV*͊ZYoF\[TVs?6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbO'aod(=W9ЀɲJFث@偊\bLU\lP9t­r#6`1WN)X2blrI@x.h}1U.a\ ,S=J;)m&6ªWeZN]6Vn,(I-LUiJT]1Ul0!sb+$e$cL*QW/LܩƹA1Ur*5qWe↎8.*+lRj w\*Wl れP; @0bMfb)Re\**Eb|1VҜhzlPmiW*fWUi',,Ur:b3rژ j68n*6SLP/VQd`h21Vz²p)3hzg4dg`Qזj-D+nc$ySVf+ W|W qd(nت񕊮͊6_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]hTٲUUSk;hlUXPa/kjbhlUi|u1BtV e[ELiUV|lҴd8iV4UqU銭2f7Un1lU|VԤL(PyrBKXfWk*6n8ަb0FLbL ˦*ɖ*ѓ.2IXe㊵.Ɩ`bM(˦*єeK 7mipTijaWz[sPFj`U\Zr[Y⪫qU*UgLR%\%LUx(Ux(cqUA&j`JɕW1b@8G^6)ol T(n\U-5*sPv[*u͊\Ҷ6*rusb͊[͊3b]hF^*2*ءsb6*sXu͊6*ثbثyWf]vlUٱWf+Qŷ4kZ%q7e3F>NÇ(fXB d|^?d=bm\h4u2LUҽ1U#5wœXДSyfU@bʌ paB)(cdlUqWe.i٩Zbf&ƎgqKYXjbh]UҴ]\Uu]زvlUf'.–Jb'y5˒?Og:XWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbO'aod oCc$f1Vvjb^(p4 '6(ZV*rWW51V[,NjS C\=mhi^Eا UO3b0*9c| k *2Rlq3 V8Uaʮ*L8U˩ZrN*4閤 Prq_lw; "*8*]/*iUV*tZ',b-LUo#p0q)V;XN8S" 'F͊XS V危UT51la\ @WXRL884W|UMX]7…:U79;m]:M_lJص)G\3A eUSYL=ETW`3g RDzy9t\iֹUF4*XxJ\gO8TV@lC Tp𭊮OS,q% uaq:~wZP}cW쀿C(Q~Z~'&Ƈ_ @W?G-v4!Ԥ2tv4I#1rT?*x,$5;o7ˑ ?ݵ~kJyӥQ*%ʦ^%ʦT㊪ qp%QeU\bU( $ƕ+Lb[ bS bf*sbW6*9%hP(Ve[/S⫲V͊vlU]\ثYrVb jaB٩6)nT[j`U[KyW7o6*ثb͊5p+D`mB/"17|D]X;粐N6QR +R0^bQ.WjLܩbo;,P8ݍmCy#, L#vXZF)o0U\Uزf1bF*TvP*챶*blUءdcz]\R9db զ*3 UiaVZ9t'y9w?k$zOsL3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbW'aod sG:c$/r+yeb.D,`CY*U1WcbƓ[(b8C(q H4w*ݲmLUa1Cǎe2*3V헅+-+uihq«I㊻cnCuiF*k([(UIF͑U5lZ7)q+}Ǿq\U@sV*r+Wu2*0!ˮ*ebf]\U* #,UM]qVʮdmV[J;jKa+- L5 6< Ua8[A\cA\pj1Iԓ^)kZ=1UH 4T%񗑀 l2Ii׾aV[Xsy9o.[Wa哅UV2Ӂ+bẂW^V)\0*3Wl Uu3blUo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*sbusbk]0YV˦*l(RfJJɗLUy/kX\UYt LUalvklUVfX_LɗL̙t eS/Ul8rϕLP&͊LiZcK TL`U_U\wL*W.PɗL ɗLUcIUa51BtV˦*S+*S7ɖ#'lmV5AȐP"y!o%R?jF;$f.4ZTZQ8ڷfWppiLp*FnGT _G Q)*FOڡy"t&(*mv%o 8[p@\yN_Ƹ#qvGSEZ?@UH5[/?8eA18?Ol:|vFCނ;ʃSқ[붳E݅^"Ta#e` 9\{W'jF^cJ⪫67*' qªllbE( ^'ƕªqW"Y&VYUD㊶fTY1`JUL⫃ Uw, 9[T[jbn8L*sSlUs`J9*XsbثyWf]hثDf*ˮX0)bW6*lإXp9WV͊vlUثyWf]+tj)/$/O/ǒL4AC^ߨg?aB3b 2vƁֹ{Sn)v7a[v8bGlX Up+Yxʮ*昫]\RY;b 5[ZV4s2(PnءJ\R)vf4\1>Xc\P죶*bf(uZ:(-*r[aZ8ኴrCl+@q?k$VsavlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbWȭIBX4?QΊX&-W6`1W˦\bL 9*LP RLP80!i8Z$ 2A+\lUf8Q8-Za\^p`JrUaWqbiZU b0:╟gR 1BEqUȪƣ)0hiRM7V-TY2C\h\*t ŕ]\إـ\NT nUf)q\U1JܺfYxU\*Y8eaVʌNSaј⫆4\08W-"uVʮ*zcyS)TU\cqUDP2\S1ܨw Z)~ 45Z|>'#)S0-"ucWZ(mx fm0,1?ʵ4f3EUt}RkWW+^6^c 3b㕊Vu3blUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊NlUYtZ-,bK6*ש /*<«Ke Z=sma9t W51V0\銴Nl*[.ҭ皸ҵe!)9T*t l`blbe銭/yVLbDbl8w\aB֗, UI˦([4zX)-+ +~˦(w)ZdjS(ZXeVS]1U=:o*{oLiZ=Ӯs}-oQpJ0ozREIۍT8'x * ӏ&b?~$rV袝) |UF_LUx_jcyb9aWˮ*S\\P͊6)U9]Ɲ3Py`Sh!ڬkunw >XB\iqI OY~['>~JZ܎S#P siƣnGOo%ĩƙf.~l2HORqT`~GaU+*e+L '7**eW,EqULoIWi60*͍+\p%UfƑU\1UU*Q_( T]+KaPJjo]qjʮ4VVQvVS7l*6*[͊6*ثT͊Fjbu«fZLU͊[ U8aW[jbblf[͊6*نhW5hbz}3IƙW5'4s_T=s)5w8\eqUli\UQeF*KqULi64*e8Ҹr*>W WIbeL #bSAW\UplإܳS67LUplծ]\isbDl| V*[Vb͊6*ثDfZ#6*/Se…2)*bWF)l6QW`V͊V*ث`Wf]vlU٫4 2S )ѷ3jcZJAf3QiڒܥF jwqrif'vXlR\Ua *WW|USlcyWo.]›Ut*v-n*쳶*RqCP[iW*Wf )i˥qK+N;*l*p+*bavbk4.Mr2䫠>՜)BavlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbgt$-LHKG&$9p\Uʮu3 U2LUٺ⮮U1Zusb *NƓA\N4>*,N)Z@\P9t­WXX#"P|qѦ;l)Xk]bmUO|Vk*0U;&xRVuqU늹r(SsU|>8UZ*y-G +\11;e1jVC`C 7Z G [#,b LF;XsaCU1KD* V;⮦`qC)[Z.͊a\US*S8E1U^J+W1 rOX>I6F/?/7NS6ńI э&~xHZ?)S XRzbYzt8Ҹk(…=jb&Qqb!)U`UuS USULm1UU eR$ J|b+*sRrbE+XXsbb͊]vlUٱU6*UMf«bS1Z[6*9Xx9+`*eb6*Vb͊6*z͈[c\*t希>!l&C M EL'q2vpHs@)q jqUZ R,]ɣO|P\@늶 v[-4(u2y}6]H]͊]\U{e7_lT3.ء*rL)n i R^U(I97­ R쭱CG.aWfʦ* |5˒WA}?9R0͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbgt$-LdoG:B$1VW].D.WثYV8'oSJ*1MJΙcZNaZdž+Xo`Vy l늭9{ ʸeiZ囦o1KYWet7LUq8Uuv˦Z[(ViZlxY8'u2F8kuU5PS,>*hr$SV0Z', orU͊] p N]qK]LثT1Wf[(b.ƸrLR_UkUz riUd\VG'~-O伎!Sf<w' HwN8UxcN*UF36T(⫆lUf[6*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱVblU͊Wr]0+*U͊W Ucp53aUUL+4|p>n8UgXb1J "xPT%Ƒ`APr< Imi!S8k j:kV_՜)`f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbgt$-LRsG:H96iY\s i[Q[8SU ®˦;z⭜l0n!S2:JLxZu +]aJ튭8Ƅ$t®16RƑ\;*;.0c6*k]UF]0+YuZ\U318tC|U xZF5Ucbz銶qbdu3 *W|Us }0*o w 8+#uZw'lPx`J˨*3*j#0Z]UrVm51VY* 9cj UW2PmV|P̧CUUew8QV.0QԜf+.V,v[X-\|m&]wVV6̂wlƧ1qP8Y8UpXxqJ^VTQ 1lRTGl تo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ٱWf­W6*]\ثvl*ثb͊6*9Ujb͊]6*YZ]1C\ShjbL+\+bJchqVędbhXVª2>XR4, Pq`B`aU6lUa|UyUZ/ /LPla|V˦*ɘbLLPɚS20i)ZeV2aᚔ«D훉].\Sh`1UV9٨0+AOl=WzZGLUկSN*;1\vKܸTe cƧ|czVp q'*(y1T_iQ]3QI6>\FmQPTmO9c?IHNW,(T7, W,Uw^@jB2xf~1N* ƒpp(*r][Nj:W#X8zbqV޻ܱW}X anX]1B&^XfY.E_./i2 V23.X\Ui..;*eZe sPbr1U\1U%3P­-2]ewL |Z -\0+Z[z>Xڭ`klU-dmcĨY5Ktݞ?M.Sc/M1~7r6#JԮ}=~TQE*C֔o+ 1LE6ȔOGl%v8&xSOVer8SۦnXUr\mr]7,UޖX8<űW劮ᛖ*J' *ٰ+a[+\Jb\Ux6o2銺6*9wEFmVW5F*O+lUl*ק)\ X8U{`U2Z#5qU_<*1U3816XFث^PlUiLuqU)½2pم9$)J%مk`d?ȐU(5or*E 95-,O?؏\Fm%3\Baoj#qFPц+VCov(xF28-W ~6|x|1UUMe|iQ4J|bَT64p%rQUUNY\ DaJr*9*b[6*lUٱWf]u3bHc.^RaS9« ́[V*sS\V)n*rUWتثbR=Oݑ9J=4\eO|fAj͐Yڌ)^13r*18\PS[T ⭌BqWf]G*7z⭌PjZ9chS*ᛅ1Weqsl Ԡ[9X+˅VƽV,#/56)urKD[(*߆9w?k$}?9T0͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbot$-LRw\~ lQ2 )le(p9@Sq9xbcVbf;`VW^WQW|UǦU+uqW,G\¢J1UB5 pT)V-+JUUk+6o50Y+^+*L O*[`1E0l+Z3^PWS=W3b1#0wNxU8UU٩-W*NJ UiLP'5qWS.[V튴r@\U1H[C-qVcyoLR*:e s $bԲ*){H6qaVgc\>sو[U$}8ue 2U2*2•銮/D ]u2U1+G6us`U6*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثg6X[*U˦*lysbr9[r銶*ߩqWzd`Wz1\-L*lPrJi6h>l ,UٱVeaX_Bzb]1BٶrͶ;QbL1MedPcƐd9/L*jb cV˦(X_50&]0*&jaUSLUaV3q Xd tVr銬g9Ui>8h* Ow-R1$]7P;SF ҄-ZcչQú8]|_;NpYU6Wݗ4\zI_'(S:m%d5k(W pگYakO?4Eom*&۬4c%ԏq[x:? S\-3ZRhx^ B Rz$UƟe0RPR?BMbF;d"۩ /G~]h *mookO\HɅ(b)Jesjp*nXUz@æbw{rWG*/*ߣ^sWh*j9b֝sW ձlawdžnXkn<3r X~bثb22aWq5qC*Z < ~ʛbS7,*9U(ZW,WUe-#/XFcLثDf«J #.l *\ULW ej:NҴǃV3aUˮ)irRhAڝqEu4J:lnHa1߇&~ ۿdxi,"xMyZ̓m\ZI(Ou{[>~ʞ*TzLoM*~cJ)>r F+H**U[( LUQ^D R^G+cHUQ_5N**l1BXzQko6*9VlU6*ثvlUix.^(RaL6U0/TV͑US]\إr*sSFV)] 6*ثCDO85g!d@VormIfCC/N$58;ڤBBqV9w늭hqKtzbvW|P\P18٩㊴sblcw[lRis*2 (P.Z9 U*RPXZ9g+7.Z9qWYs?!%+>՜*bf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbotd-LR{\~"6i ;e0*w;aJr*] k/ Z9W+Sˎ*W qKcLiZ^JqUf8RڸwX *s-0>Z$d*&;*QZbV]aVp!hp+KdqQ,\p!\9lpCwWiZXFPy}0*ӖqWe,bتRur*p2ltǃ0ubeIWUr*fu2[ZaV\l? G5,KȚ-+E,vS)00c PtķRI *]2&8:`J|U˘⪀cI+*3`Us`BeU\Ux^2\3U6IŹW ثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱVlUilaU2sbKf(h`1Vc*YVʦ*Y⭆LUY-ej7Z/L*3SV­LUi|Z皘.jaW +*/clP^Si3bz\UL[r*K L8Pe2f*ɖZd˦*˦*˛*˖2B&X\Ua51ULbm&^*ɗS2eye*LQ!2 `T=[n%l!sAഥM'oN>mHbR_ wƕm{J'S]) *{eAd!Z2iE#S4;mW$mY UPF{mMpRP ƕNv_6uүL`cjrJ74m뛝qVs\-UvWz+®`ثb/ܱU1N* \UjKE<1ZW,U劮XUp5p+~ZUJt­rh{fWz-m]މ\m[X%o\ڵlN62ÜUi(pڵfڵ*_,*LXiLqBҙ)\*jV坱U3W VZS5p!oZU,ULŏLUM6Zx#5qV* qK׮^8/뚬F[%>,(ۏ LR\y^ [/,%/(C4ZzM[ܿ &o0\U41S1Wehn(]h*'7(be*)T-vj٫]h[U(U2͊1lfbթ\{agq& )]9S6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbot$-LR{\~(fT6)mrCgqW O|Up˦*U1UrbrS(Ku\pc*r↎9M1UrWW*늻mV'*\F89 eM! ij⫂`צ)qbvlU eRW v+NUfu :U78 3.ثy)h jঘVoz`Cu*2 ZnvQ8R2q ].yva*?[LܩRWi2*hFUqVp* phlUq4s$! yt 7\:ZB=3S-9 lxĿkߡSP[@AzjwRp2EPUQf9UQM7 R63*^l +o(J6*fWf.(eb3b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vl aU*[.Pli+yUyWsVe⭆́Wr͊(͊ UL`1U銻jaW2.†sLUZ1b3i2̙t« *ɚ^n8^XF\bm.^)r\Ui5)4/ت) 2eZd*NtVz5ZoLb XnTR1&=T;_%i}b=*^1TI~C].-o=5kb9R Ϧ$҉i(bkuʡWCQEqUEsU#+UU)UF;UUEl lUp͊͊6*ثb͊0TqPrIPL0%plm1UU| f867TV˦o7^-7c;΃kfe~O W6LqKʦث6XUelU-N*s Uَ)o(PW\US7\▉ZQ#ln*sbLU/Z2UbU+;/\R쿖)hjc;X†I4ƚbeRq텞g]e >՜*BavlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbwtd $\~+$ S ˌ;aBeָtSU+r5LPmsV)NB[\L i8n1BsS4qb]V9zbl4qV v8`coTWaUwp82U65ƝJ,pg+mvXULofl*1Vφ*] l*q?,TmT\i q9:Vu2b]pM)pZ5V6+*W0n^*f(p\h58dS.qV˭wVo,*p1X,h:EKV4#t~ NT60/0n*?7`يKhJl k߿4^`J2.'c:)VkVU'Q8X.jbS\8dR 9Xc1t1U+]"()qͅZUo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb JϗĜ476 |0Zd㊵eq]7UYTWr\7Uy\pEV˦,gS/]eb2}LbL1VtZ2f*˗ 2\ `bLVqqU\Z2㊭3f qiir銬2\Ui,.*ɖ*ɚ&;1XfQՀ9k 7lmPDiqu=*[E$ zg!r;}c$ʸ%iz+*|1UE|iUL`JɕURLbT|n4ʦDY[*GTS^3b]vlUٱWfhp8P\Lp v9am\(ⶪUUWe`JU1U@sUusP[ȯFk7yWm,q`Ʊfq7V4]i7LثTqK7LRc(leWo6)vXZjS+51qWeSv^*iqW8ثt]`△r]L+cVLX[ʥ1K)vc3.Mr2zOs!0͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbwtd d0psW$!l(^N^e#se:\o)m`CC-*hqBeR<3 3"Zc\cL(k/BӏZ(w-T0LU߮Xjbt/Vf-)XZ WUXs 특zkRjc*ܰ6#]ZJ⫁LR1qU6jbҽr⭑Zs*, f$bl;m+FHVUʐbǹ0jUfb :`Bmˮ-/LR'P WqelPi Q(튶,i;m 働#ZZ`Cr~WHm<H>!95+}R l8-Sl;%}i5S (m]Q8QFQUck+e+ˮ\l Ypp\V*f!0[6nVb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* rWW6*t«KRώaB>]1B>8m tªecJr*sF*6l *aSql«LtT3W. 3qVS_7*ɗkhɚi51U_|0&X)Ze>9L8i/V+㊭2, Uivክ2*S:Jԩ˥qU%=L*a\a䈷@p%F[L~,,ڟf0}qA5U l((U}Ć}QP8KԓSkO/[(۹<LR"nXnr(|rbD⭄޹X.D ثW5p!މ9cilZ1卪UDv劯s㕊]sbsWolU[\U[ᚸ[wث|sWwث]fZ<3bWS6*f]Lث`f]Lث͊LثyWfZ͊Vb͊Lث\* fZ2ElUM,UaL…Q VVapH͖,2bLjbLtVze0.]1VZeⅦ\8W.F\wUa0\Uoh˘ Ua.˥{bL:>I@qU'1nU9u(#*,dAm5SőӍkћj*\}k<"V{bDP<8bO}:*_?}!P| +>e|eI-❌އbw#cS[o/Y[j)1.UFeTb7>Nٹ{⭪W\K|lW9U^9K~jyWp\PJ\-ʮUXʮ*n6*lUn^76w RlUٱWq͊6*3blU9WS6*f]Lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb́]LUf]LثZ)\Ui*Ui6 Y-1e╆6L90(hÚޙʮ*L8ҸrcJrb!Xaalj0"/U_,6/Zg/*fLUi/\!VLXmH\mZ6;f(XbamZ2Wr͊;KEG|qBF;eTqAQLӧBq!R.)v*+L/RQq_@R~vr0 ~\RSF 5N-qn8@Ijq&)Қ[y_]O6KOT^%A\Gc5M=]>65H\+ULQ&F)DFGcp%YcUTb͊͊6*ثb͊FXT\p \rbq*53`K򩊪UWƟ UY_J6j`JhīhpscO3#6o/]zwȟ_g?zW6.>Lh%!{↳ v.k(*⫲m1늶1gn^{]bYh򩊮RͶ(hU1V뛉]\*u]\|bIPUnnU\ۦ*`eUkeV`,Z9xu.̦U \{agGa\)]o}?9T1͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbw吮'`oy % G:9L$Fb1V\lてk*U–UqWelUzS4) NܑA Gn}0ygXݏ?ُ:c%>Q}phdAi+N+I_I\iU:|iZ @yq- \na⩤=WF0bN)D%JjAUaaB+6*צ<3WjeW\*rN*X/o6*{bհU-e`U13bZ]k6*f]LثyWf]AulUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3bhx*\«Je[/wZ㚸Wp\Ua.PIVqU<GShEarcjo4/*mahfckK~)n|2 7^I /נ F+J<=qE!6]Uh40p`v-T0džɂª@iY4!$_ZKQJ%a>銥Lm O*0xM?'oO#D25K-s"Xq)MBA=KRNzn<(;{J27qVImYk}#[8mQF*eAas5TSr62O/M.?N2@ ȌOJ9\ U`UU9UٱWf]vlUٱWf+UBU(2HA\u1U>[HWVW*GQ Dex*w0 ٸ~6 xYX z,b]qUČk-N81V]i*Q-㊺aqWW1[SpubF5\1KC+nT8k/;5pٹ`W b9}*Z#*c0rFW.KD-k6(-ءdT`W ʸR* 5KW[|Oq1Lsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثboHIOģ_H|4Fى*7 Npg ,.)k7RiBqVaP1CuQqŸG\HDS`=ePFRbG^SJʃ~W o*2*o`8U]2(-T㊭SzaK`*aW M(TQ-.lr*Ri*`W18*51b N^5vZ Pኩ7ƶ&a rv8Rq]Xi3RRXZ9(pWfm+•æ>ӱLUpla\Pr֧!Bӹ7 es4]x}Z9!=)-1Pn)0ʮl p*RFcJ챁[\Uṕ W 0īc+(8vlUثt͊lUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbZN]1VSvV*ثusblثyVbثh8\busblUsaUWrʦ*Yjb˦*]0&j US5l>jbLUªm!(<*Ls FlbS3bLV2Ⅵ銬/L [6hU0\Sw.}$ԭASbFAV;,GͬHdP)G~_Z%۽H#L okIݦel>I''i$((bC(>9T8\fZ<*(LqKtW,UsÚW͊##­́WKas`Vu͊XrU:f[`U6u3bl f]LUf]LثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]u3bS6*9V]6* \Uj㘜U3h2cjÚ-Z]qq\[aViif劭XjjB20ک]qE-1 ұLaLmiވm<51E9oJ$R}*$ C.[08B[6|''TX \U}(LJEi`dž Pjlg Xb*Pq u"l w5u0V<9`d:4q|Z^~ʁb\TIpd3-mL c]i%YyT )6]EM+qm$1ܮ?p5կC)y̢[$PYZ`|wUU9ULثb͊6*ث U RrW *:dM [|qVHUQ"8Ȥ"mвַ͌?UuũW鑽q.ƚqHZ9\R*v[kqWW+ 2N*2Sv4 Ky|N4N8be*͊]L*`Weq,bcjةq\ LT;c,G/hplPPeP-L)le®nY?!.InVscvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbw'QGBYH?QΎ{٤™]*ǦQ­5\1Wi\;qU@R>.qPZtȕjc"W| )H+Clk *WRoY.­ALi\pqnXo9@Ww,L*<ءŲCث]3+eVt8ijfZcӾ*pªeb^Q6jSoQ';,Rf†L)kl|1V^C\r*ZqVg /*'1;aVP J8e*E덥v\S t5[I$cgr[+ Ac+o5gs]*([f#q,.*ѓ,.*Ɏ ت^,&Y̨n5`Urk#oƕcK"sWR#4wP=g#v8-P6_]:SڟU`V֘uƸUU7j 0 b`Wp+iAl0tp;i!%׵a$|ڥQcV5 /\!=*id)Ӿ4Jk'ciUeL 2*8p̀qJæ*匊pWyX`f[51WS6*Wf[͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Z9V*/[6ث`V*`UD S/Sg͆LLlKVĕ8Uy`pw\UQҵf<*W5q$/VT'U1%AT$t B|bbr9t¶sqVN8 PeRg fLb 7L8US,-1p!a|aByV1p+FL« `bfC|[blb98#M aJ[wtSs}BaT -'lúfvhEa@,iS+o M%i &#}i9 bO@Gi1ʖ+c?$n$?~6n֑ZQ f}һ񴫤'L0Z٩q*Z3baS/u2*eLU2\R.V*.lUw2Us`VWqʮ*\s`U,ت3b͊6*]Z]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU͊˭0+ES86*,%0.UT^kOqo+fpl)WDbeq]*1Cu˦)us WW,o*0+avUNvo*˦]\kCU)o51WWF*WLUvV*[˩Z8b ˥1CC6*sS\ULUDbeU?#$VsavlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbo塦'`oy([ si\4|[c0zSR+ lUjGjb+W3UC|Pc+k \MqhPbM1KGlޘ]̜i]ƹEyU8 )l]`C@U53☥j60«T'(MXZ`Ve*in8&|Ux#\Ui̸U\XqZ`UG ]F(l㈮XrȠ\1B]j0Uĩ*_u+BӦQL1( olY4rZ9TaCkoT`+vp$i Z_-FI ɍ(~y)[hcT:#t{ r J*qEƓQa5U8QU2*qUx WqK%W.Y F(WS*`fW ثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf\3b9VlU]\ZrcBiLU٩^*YT[*p9+aaWRUc6l*(­zbsp.sp.XQї7)k+%ʦ4߫ Wz.@[Syp $\PyqB+hMw ͊4tT*_.Vክ/*_1Wz͊_a\*GS ȦpcHY 5Q}M:VLuǙ!8c-Qz¾P\_ۉɮvF<*'{ >ee~´X*v9npiEE4j)EȪÚwa)tˮ(p|K|«yW08[͊5qJX+N*U1JCL `UPD⭄'W땊WqlUsbثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU{`Webͅ]vlUٱWf]vl ثaWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vjbצ*ثb͊6*ثb́Z͊t\jxbX׌0F8mPYs;ca(/qX\1[q '6оS/jG1܊!NIpA\i}(%k":W$ېq$ 0+bp:g1V*|a rJ7_בb /cYTX\O8*n͕FWN3^b'rI!AE:,!#‰b(ql'\f(Dr *3W(™мv͊vlU`U)%i,$*S;-2U|c.,1ɍ#"lrbtE&'0?, FBs[ͰpKOWĨV^(vP'n8U0iLRb+)vUٰ 7\2#+pdLP51K U٫3`WW*Q­+leSjb<UZqPA-e6;15—f+LvQo 5ȔާelSثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbg娮'aod k#atIEN)A iP-W|mZ^,qJ|ثgcUrhbQ+qce#,| dbRRqUFUF]NXWƒp)FU9mW4|w|ro2^c*?i˜pmUU5Pr_>5 @p+c(&iLg/-Xnj⮦9p*ӊq268RjSl lpզ*CTf®1+\R0YaqV٨1UPbڸcf*፮bY\stUqC] xjۿKt=4[i1[i0ͼg~`ZSRɏ NUo(F"NW\UPf^XxƜ![l-͊ ؕ^(J UU\\j51VlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*͊*㚘YWeUi«1晀« erV)^^n5pX< (Pvit*e [sqZ2VsRFlkLrci\%7 6ZcU O1Ǫ<p\Pi㊴eSkw*W/*W7ULb *8.*n8chjتRklV;i+V>QG8;@9lƿ~ UW\c6N4UoMR$>CjY=S p~_ 9o8MBI:4͟,UkiX4;h OlmEqUA?L܎6ֻo<ܻ`Ux훎k1\*;e\N9E7Vh8kwc\PҦ&IU@-bLijv8tS$ejs]c0*"qʔZw[VaK9uh8eWzV\PtV|ewW\Clt.L+!*Y UjbO7*hjtƂkV.uÍN3eO)LD19YAdMؐ%Tm<]DnإTNXZ18"qBN*2UNl 2*Up9W iR(Uxj*jJƜUxpy\:f[͊6*ثb͊6*ثb͊6*ثb͊6*WjxflUͅ]\ثolU͊6**~ثfY6*,Zj UkfJCX\*[/(X[5*|1U+_, Uil1AX<.*yVz#hU0FZL@f JJ׫Nfި=N` wXڵubI'j!m'.!qu4C cׯpZzpO.O\G5lJmbVEъS+!G!GmGG$ͶombE*XLQUqUAUr*a\UPE3E[i/^m> qG0U"x,(rRSjrf6#l<*Cm8_|A*v'iy >W<!o}񺞛%;aŔLl$G,lB0wx[ᆋ m;qDRG{Ϩ$ɮ-aZ Dt=/MD@*ƻ0Uۄrd+rՙa64i{R(5 >G#B|+cծ1"rorzmԠ_`[{¶n[W0S%iZeS 2]b5+eU#vz# HE,wUwwy:wqۦXe|44 f.-S*U48!r#ٽE2/3\{:6IqPpHZ8޵~4ޛ;2Hj+c˟0^N8Mӹ^G-clzƌ4hSURZ׾eIWe%VK.'(wwV d_ˠ«WlUԦٱWf銭8 $tbrLJWsآ1W)3)^e\ D؛&^yUfgc< =:'˜AJeܘ2vպf')k/`1CT`KT;.v5oMJFp 1C}1V5)] )v^vjb9X+o6(k6*إٱMӲ+nmh)k1늻,*,`*oJ~i?.\UާehLsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbwtd e&-~Ζ¥#gr5f[&3 v–dZPv h1'I[lp鄥18cq58ҘJ]4–ը)VZ(z#| Kd^:\E:V6lP9*0Rt 1JӕQ]V8n1BlHָ5ak-wr!i*.mc˨̵81U#lLF U+"M LÖ)Z/n@2b[  FX2⭁Q- 0eS\M3p\ ӷ;1VƇrVm*zbF:rEB!i mڋhV.0[yFKҤ/ʥu:#&Uz(:R\ V\p*񚸲TS4⫲WT\mqJ dUYE2.UqU_®LثyWf]vlUٱWf]vlUٱWf]vlUٱWتsSq9tV͊dXe˦k#wL*ejdUU^XLv˦R'6*]+[7Umsb˦K*UcKJlS ㊻Q\Uq⫹kjd|z PLUV,཰ *.XLUީW|U\0cILUL˗LRї+;9`bL.&|qUYl6`=VM1 ?C?EFFq{ 4IegqT/$4OS#$ַ_')TMOS~5O]Z^_IwTLz6sQ'X֟OcJ_%?ޙ94$ڜ)QPu?7ՈT醕erU5aU@4 UTߡʮb;WWʮ)]L[]5qVWebȡd cA\Up[W*ȪیگX@:%WQE"_13R8iۘ_ёhdcd Ӷ-`KcG&] %/R-ç| i,_^WYծo]LJ-^V#Z50DTg0yf<_lʔZ!-֥pSҍ6Gs/h>?(HEc\Uh SIj+jȍ`y--KDrOO̜z MmW[QsRy95쑽=1y%QoZQ[v|nFraPd)iWn#]^iNYbRZwa$944u-mk$կOzW'!|p#ybX]T4`+~w 5kKT_6S"+dڔM:a/siHG@opJ)utNUrNBO7r_rOԱ Ū v<]reu-|Z۠<\4yS}GZ),J{HnE.=GG,CEHGC-^4kH¬/|0->"t*MO\–Y&%u WOchZ4OH,Yٛmʿr8Q }]Ga+sJݳ`r^lQ!AZYlA4ĮVcjDy" tŐP;JCa^"H_<3+aSVELe%ĥxrs"=lI`M\(??OVb~ja ֟S+k/a/Osp~fK׮hV?$.72mgx3;|(O,C%Ǧ:ՙU!p5Õ8gsZls9ibJ[Kgi%?.[5:= J i4|[ $DP\ÎUiS[B0Y?l&mt?湑Hb,}HcfjpQڍ\Ŧ[ʿlyMvWM#oXE"aHT%J$$LџQ?/7UZl0}Negl)Mb2iXV5pZ۩ ]\+#_3^JJm͖"EtcHIrDdU]0[h״ 1ͽHExՀ 4iEP{u &(Q%9`RW VPWׯ_MQ0;W |np*E+cie(iQ ӕ$S\Kdam$ Đ)$Ė3)0_*t)SZđJХsI*ĆF*| M?N]s`rq$ 6ûXBi͞$$ޡ1Rz7 Zi PVǃCƥCVڛ6^usR)SjGLAi?kМK(,J-=F冹[*Ϫ15=US{Ta5؁,OS5JH*jWI[J:%DQ(;V%;6wVُږ^1͡t3F9ĀXOzUdS u;;JqSf.F5L&BezxۧK#H [/spқCmla$Ls5dh?QmcM1z`X">ՕBF?Juz`ymJzWjD̏K`15be;ֿنXhZ-s[*{Y.t9o,Bs`7qK,5Vx~z"2vUh0!eW}qUGvQ@$\2 \U;Wfv_*bf]͊ CG.yXUٱWf]ӳS )SZrVY]\Uu]lRثN(q^iP45+Og7ئYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbtd d1M2Y$ vz;MU#l,mhqBp9LRvJk}]]nN:[OѶ^lr=vĪ%M2SbЃ\Ul1콆*>RTbWǶ)S(TSP\UsPTPb<0?< fZV*/iV$*Lhj`B)\8(_ JqCU \ їbGL)h{X⭮lj>Xh4IVqO*U'Î0*tZ\إh j«)\ l2 7]XRf\2\*[$ƞ~ d-y."4f>te翆c͇jt 3V\!YQUUSTSW\W\ (RUqJcr)D&lPcqJ9*+͊]\ث`\sb͊6*ثb͊6*ثb́ZlUͅZ'6*UtTc(Sf*_%*ђء\H*LYfJ (h]qZ[.ҭ/ifU« *aqBKLPҌ01pO1\U( fW P늮LRH2qB )Eġ*Ug,qVe rV*ƻCsZ=J% ߖTxS ^ajj0ZiSVߠiB˩վ Ņ]4p%/U#.~1ŭ"~Gy x_Z?OIVJ.ީh]ɮDoi3#>S~J_MHG!ߓXf5c ׈ TJف'U3Wz#18~Ɠ^M6Uw|IEsMڪD)L~#Զ" sr! Ɠ$RftPuiO0 ޴HȀ;wǤldc""IzӾzt*2]nXq <[gKo ɾmg,ZsI إƋg*bGxitWn_4(3G|~yn]D}*ܒHǮW4m>*t=^ 3fk^'LH܆&p< ;L$ҹb*ެztq%@5"s/|4Ts4Ŵ%JCqyCr;Wn\X7A u;IVP ZSaa"<2 N źzvhF[1(ROaqObj1G h_`ieqd m e6qPzV5Nؑo^+>PBہ$ [+#2#|Z^ 7}ܩ9WU*A!W!W NFcBhےV#om?1 FE"B=pmzW|DS_rc) ׵nwS4't i#~}\D@32HE$@1sJ9j( O2:$[]eTV||gq BTv"yUd˾>aD#(s06J-q9ƧZԜ2M=lࣉyeͭj{r21Íx_nF{aƼMhpWH䕧ې:XZmc=,o} tc^&CM" n?rn,@pg(J?(>)#hClqHeҤ?!-,ma`Zo'O%?I1KnkWvlDKJs#zdxN[hφ)6v DXC\+Grgh/jة>/м· >1@<3OѰ &%$a' E*g*u1ڸa^˧\fN-8oZ(@@=2;B-O5F8%mYWvX@E2O"z9nF8zt-4G<;CɊdVhWTRC=E擘D,T᝖odHn1g)CJ9yePK_OlB/EzcS\ lUٱWf=)+cc$+F=z)*8'Vs v$ב(2Ep]ˊ"fuw뿆H˚M]J9[" 'F*Z kQ%O/"*Y>8 vjwWRKtpiP>/"ڽ:㕸П-çO[fEG˲Col'ew%畴|kӸof]RB"Q`HZ/½:uNS2CCQ]X !"_ bAk'QHU_P X'}CimCe|J-4#rp% 9]]Յ~!k5GڴXx;^rʸO$RLq&-ٮU9H=N[)zI81j+kjAx' #5۸>X&٢p--뤍 }v< rĊN2ɱ˥TAu REAx=[Q,ۡ ..gX -džݳ[D!/,(Qf෹kyK)'leEl=+S]J.+*zjݎV*r*qA+ihlPVl8hKyj+' ]S]pـ]Z8XRP]];66IvlT2*lRᘜP챊1+bRY銻(U |5*ާehLsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɇt HJ6tÅSf銹:tTklk !⭜07R1Bw9tri$CW$DQJ*rѷZjze;brLUqZfqW VJ1V#l(r 6l?*T`U2 A­ÎmMs'-Zdf늻2銴*WWA*嗵pm]\qUI>)إBCZcr04ثarLPaƁSw\®XZ`VWluF*cfneLWSLp2kkcfMJI?;X)TS|i1^1T9GU1 WW*qWʮ*0%.c WeUrTXvlUثc6*lUٱWf]vlUٱWf]vlUCY\p®lUilVbYتl¥ILXc!T]S&,LP,F)pҸ`TTr(BWXͶ8-0!ILɖF(XT\PVr o.]07Ui7bzق⭉XMVzf Z*OpN8.(C.8 UASg\Uo,e!|qJaqU07c@1B9;#ƹRM戁fo >qKh7}ڬ}L1Q EcxT7sVVNi)嗑APwpk 0i2U^pl#)4.bث?cKbmLiW.DӦ*!RXҘ U*2t~JLx!x#mWᆟ^t$.]L`SM<24I-n(hoԉ Rk,N 17(sAT)<.kJ`[--ɨ ҤJ&\ICyj>3z|0[. HH?5M-7L3C8똇(kA.3)r7foޠru20PIJ k8- 0M(M{J<3W:t8/UqCSlHPBK(yI R_8t4@Z^p=oƄO$EPC4.?M?|`&TTn(U Y-ש2JڏR=j+ˁFycQ&7kmD'kLژ[jTջ|/IjD s88eV1Ӿ|duwTKl P +cܼ-'qmy'dG fGlNmc ץ0c QWHROWIڴ+yXukFv&2O69wR]Ͼ`~|ҁ0L>S@nG?8K*Sk1Z?+ܺ9n˖Lr#U oӚ4.NA zeuF\y9Ҙ59%jblUbWSd_qᒄxUeγq1;p =VM=u2!BMWTTm5#^TdCHkuX*_34!ۿtE@Wj[mZW{9.$Qk*th_p%+1=J=k46SJz8mJHG),jP }?Nm.&Z1㨜vE/ߕ&ty)=v͔5BCtRj+au֑unX25 )T%+h3۬mN^ V[V8K`Ma_%ȡwpnrtIZң)h$=ոU@#GӚ1o(llNK2QKFky~Q֡nhU-U[!l, 2iJƒɌd M!xq6Il:6͌*FIK~S ~ǩ 8|,cMjx>ITW"BmotkLG eiw$CC #$ >'08UjvHǩCL^P_Bgj & '}|b]2B>dVc&Vs+lǑHx`m1B ] qI*V7f;a[[cɓj>'fQ?3N]R߉uBt $BHAh:6 J eK8|n*|UYqɓ@L7 bTAS6*2 ĩ.?`HMo5$My"ͼ4?`v;w=ӻ{PWW18WS/*uvZ޸ᚴZ]*U)xRQ8;+vlUٱWf)ebc إ5e6*b͊rن(.=0?˸a\VsS,ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɇtd HJ6td$cdb_|UyͰ+rծSzbUnT­ǡ,u=Tm8j|q.{bzy—3Voԧ\)Z2(1C`.RlU`8w8y;S,׶Z|PUx8L nUw+Ib!Sˮ]Z )t\x*ySu2A \Up\Ktb6VzS SL()'zZwF)r7SlUq‡X~i~RbŲ9 se *c*9UMq7 )qLKJ/Gc;Xg"RjE1Z(i5{=y8 yu"8/+X;2I~֓/-X٠cQLHL 2\) X\FPw|qQRggEIؚci]}+oi-jO{2FtNebY?]; 1e~,O Fd`,mץrN]K7N@anAT5+׶VrM4KAZ`YinxX ebШ4T=F\/: qbDO\uϙ.nJQ#4ailu"[to+ŧ1UO\\Ue3|Ul&'dKPerlMwN0]Ǘl ws$R"*w9l $ UU LQg4WRcm⪁i,bn?V@HASJ34\L"+ v#!h`]jsN|_dž9#wJ"֒ +e& GdW#Wr^s+l6lB4y%_^zy[MMJ`ao Y y3e+}N]p< X,p 78޳G*?a\xA}(mXWri[7D`fp8#$+Mٖbdڃju娀i޴kF4ynX,1]HDei ;HMʳw.#S'QpKbÂk? *Mh6 @2ap4 HJnQwIaۙꄶ^5u"7k[J/lN!-(ɼJmMmXٕ"݀ jA0ěPqg22$KRₕ~WI{CN;fnaKv$##8>#SE$ c*H6qlgɕ2RN= 9]9{ /-ʮu']] Rce َ* Ul) f.;t\3v 0vWPؤ;,KCbeU6k7\)vcWfvnU51VWe1l+Wr?#%+>՜*`f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbwHIOģ|Vs&"1*L])\FS9q>UZM],튶(1 +ǖ*3L` ӈq21U.]Y]•bbJӮ5#WZBW9)U< @A-|o.G Wx⫃fLU Ű+\qrJS-\*?6BcM+d–\pcz`UqBE*ybr6b6a\|*\kCav˥p+(6Wq+J Bo8 Uq `UCLmlUE*>LJ|~lU4bH95D ^b)&iG4*r.V*fb@r*Bq.Q6\fc+l\jU51VV*Q+0*sU1V뚘UͅVN;Z[(UYLUyVcs…b 偊2T7(hɗ/LXg cTYE0•b&|qU3q[+uSAqS,&)iaBQwLUOƘ/l{V0*ƗKi$*~Ih-/"Q\S/ӂҔfGsmϿэwb[(1ic 9WxFO2MO tO_T뺌fu5Z?D"LYe0YT;>鍒7  U-]Oӈ6 ц2C[?6(2@*mkuhg &3'Jue[_؃L G^/6́mT^VG\i*nv'.M>AUr#bQJ 5 fOb9\"pxcwяʣ^h bIйn6,zˆO xmDdWu㘹&d.?u=m^EOFF*CwT [X|3TuWA2\wX?Ali Q6AkZד @f^,\D[P'|,c_ZE(}D- VG&sQ*9SGܐ:-k*R04Dq*F54B;})jr+ݓLjAAwZ]i6jꜺVʮ* wL-h$`;^Pa cTd9* ;8U:uo5vz-R낅HV=*r5j߾ٿΘW(КQ[n**|DRxV8ҭ$WW^%uWTSjodEzeSpʛ5RzH8E2ɯqVNNwzu\W_LR\tͅ ֹXYWf]vlUٱWf]vlUٱWf]vlUٱWf#]je!]LPثb]۾ Wf0ٺl1swWr̓t1wVbf]vlUٱWf]vX4]]|K|Wfy"֙ʹXYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]]aCU' ,Wf]b͍%هݍ+T"sU.4L.Jf#jcV]2geZgt@Ϳ݊7bB<)UO|2TL5 *&qU%FU{vª|mVr=q se֛J4eLަc\\9I׌=c76<:PQځZ$oǶgRcH,Aoi2C9|/.hɺlgxUsM`VVZ;k0FA~2.;sR¹ $ؑߛ<44qM\<,‡9+V'd?q%՜*kLb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb呦/`oxC y\~Ό+rlnh@8X;xb*S S+Vͱ8$tƱ ءP8µZtlqJoJ*-*:K6{cH8kv8Rq9zUXdl0dbZ؟\UPqE-(Z\p*AVmɮ*VS W m+WኻX=*dP)R߮]1Vgéªَj9wcSmҸUm+UԦ46*nXR 9j8~,P|Y)Zb -KW(8%OlUI­erÊ|z*(9% X|m1I!>n#Okd0׎R͍O!\1^,Wn*cHW تr+*8Q4U#U.6E9g)\lUrẂ-®aUElV#U\Ui|Z3W 2fH[fh͖*038X2XeZd.XUieUi50cK*dL4`aB>:>jULɏbLD\qUjo*s*caU&qU&epZ78YJ/j֡'x-( CԵs Q`ik6B%ku w~AM{,4@!ʸaƛ~]!* Q귎Zl?eGݘO|PmOvPJQIc UQUc«9S51WsMV\h2 Zp6 ' 47M)zn4Y#$A*3&1}KJϷZ-2O$SSU,ґ{bZD)ay_ `IZ&jAsj0CO",e}jNUVx0uqXU)oL2 $]a܌ƎSUlDSm!W\ (Wѷ6ǚTHVWۄaއlgunM+w:U͠~,v5$ f\3BWƏQi]%R;TWS ԅI.c8*':ҲvݔO[XԢjU+ڂfLTi]A;Uc!VA-f]C'*9%P[Qa\Ux5p*Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWVTZl0K\4"fU6eS3ƕa/-sbr9u(`WcY8-ipsUU~cj-]4;ŶiW[צR^]*LUn8{]1#]AW)=VsrWOlū1^V쏄¨o &PhjnAfe6HCYjB+P~Y8]$sIӂt'Aۡ# nԠd+#וűA>RbSӂhz&ؠNE&(ƞ" rvɘ]#y^ENFݫ&m|8J(}E8cF,HJ5-KsE",RmR,aU oB[CB˩•$8Qq-Wdyɘy c v'9˭ |2 auƶ`FqX|8Z}\2mҔu=.\ AApScj]duSZgvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbo堮'`oa [sWMJHmJ8Rs*>8ءx̢|UkPjWGC*Tdg3H8t[BOSYv@ָ\bF 6S1>5;V''N 0iA:b|)]ʧq>C4 bppmL350e\ XV1P`BulPrp*lw.ت߳[j1W!Ɨk|*#+MJǎ\cm*: *ڵzeS [q8Gk н1l)`J2^me޸:8ክ9)Sc*qU@E0D£aHҀyWuG7@0tCxy;WWv^,~ 1G SWWتW M#ƶD.UqJe *lR0*sUr]]\b˦*YVecJc-EpAo2{i||qUL0i T̾L|N*-qC_|wUi(.hɗAክ2e LV}«_|b `bm'X\Pώ* UI.TQgPUV*ѓ.㊻`0$ *M1dfݶ'a fv$[}2,RFuq[0|  Qi>Ҽig/ $ZiN8(OSc=jg;{ej$LP\aWrJb,x* 2[-lP,+FXUW/ojV"{H2LGUqEL,5;\ Cu&8;Ӷ׌"c_Q)es08hAbЬ^IڣW۲i(?l-- kS2qaN@兆YP5? RklT |:Uٹ[H~q62c$V.}d-+B0=I郒ᖭMK|V$,*jEr~X4hZm=~X+ Sҙu*C9P(N%Wp>X[fp5p*V*"*eaWW6*sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbsaU3ˮZa>г6}BFjjњڮ+6srկ.Q8ڶj9UJ;ebxˮ*@3bKWr s UԦ0+ULUiVI= #T2bbN˺a׳n;VzU-ҴW\=$};gJӕ-/d&H_5ښ J>en4ŕ 4V7yv޲[aSw]N0~4&}bKvޡ?5v ~Q@׶}e8إ܂xR Q%{Q:=>4?*ŨR}Me܃oׄ#o<zxˆb ~u.+*)_0E> k^(YM*0ܵBEF[ )RaN,LG& ٵIGcׄ2Rm"I 9ߐM64j2]0ny!m^H ?˓{TFbS7jZ{HUԂ"!ۈXZ&ճqVL42)lثu9T \U`lUClUن)vjWv`0+Cb]e9xG,⭌a[1Vbcp)leF*LVݚXWfv8b7l*PqW?k'lLثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbgt$-LdsG:VMELmi q<0=%cFG|x+JfGm W.kmqƸU` ܳ))[|ö*ا vU@TFj危U*AϦH%rcDtW+N-^^|sm6X(i oPc#*lg*m+:WcCLBY銸>9Y#e*݆* V/j⮦9EqUs0]wBZ1qV4—=,>5ȵUR'Q0s'0+Nu19(^Fl .VQT2qU{[[\W[l57kdIvh"?vY؇yTkfkL'7LU6^QUp9X9Xr*تr*W%tÊ4Ue9C8TTS;TW+q| U(%0FLp^XL ˛*ϚUoO ͚-2偅V41U3.jb cZd@1C^P늻­銬3f-3c36`PeV<.Xf|qUl8UMኬ/Q-Uk]+V+UB+]Xy¤PGӊ UVfW!R;8$Sqm488pNpOR.i{x eLMͥ?i#v x:(vRq&(lIl!ƃUby%pZ޸-eO i? mZnGHwL܏|jXw\ґlk*?)xGP3^lP!QA ($fe;24N{w[ME+kͬʚz&6#5'fP8nص2lثͅV͊㚸UẂ e⭄ʮ*&V*ثb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]u3blU͊Wf]vlUٱWf]vlUٱWf]vlUٱWf]0+j*rVqV«lPɥ+qC’* za ~?W3 ԑH}Aq\F+KHPӠ<r*wz5h#s0m^ޠwolL[Lm$ Hߒv*-Y=6iOY=hOS*Ŕ26Y2+Z_5!!<(MOCM@(Q{DX- [ Jบ0\xzX@3MF{tDCӶdRFb {li튭"Y\Uw%@mLQ$Ub>":Ś!/R~luYm 0eaR0-^ eh)qTp rY1BJvo)m%>}}kDwWW&\,NيE6&zl4;~tFzt[#1+mqB1duqK]5ۦ(]\1C1V)pƜ*X.\X9tD`W (o51Wf.ƸͱZ9\p+S \1c,V\sW vj—f\rN(hW\FI<['eLLثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbotd $^i96I" ~C<0%gz\.ejpҸ:elLiW㆕j(ޙ\s\@8 T<78RP(^#̭C\Uk(WYw 28q@θM_blq8rlF4P⪯ZmS VL5lqUrV\qWLF*3m* `UD`{AMUVTR Z@'(*%FW |dZȥ@s)hCP|8R"F^(sWbeMVmQ5+4\RS1B▩># HCRzpJt0\{˳p#}5kT89T[6*MrWS^jb8NH*b)D9TS+:t—W51VfX_.ov b0KZdLUi,aU銭/JbLB&jbL28i-WZd 2㊬2­}b |F)銬2+LaqU3&;*˖ZeqV雦*zS=-1C\j@,,Q(/~n|cOoZSuѱ .hQA:=#i_.yF%?tieAI&#vpK  |p\o`@|0W;rpҸ `ث劺5qWfZͶ*2Vb\U9X|sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثyWf]vlUثb͊6*ثb͊6*ثb͊6*ثc,`V8`Uch>Uo!w,تsbfZ~YiG\km yt8eq8ǦZn'QUh7Q/TP/3 ,|vڭΘW^C׿V[/9w8zg$%‰#MiDRMR=&waB:qd4ZP/Pj\[AEp+Og՘&)]2lGE3`Co֎^ .…2j~Y*]qWp%HdXS{Fڵ u8̨e~V,̪v8M,=J-.1;70VIitAWxO!&?)O|IS_PK b4䚮5a0O\R  c2IDU㒻w#C6ƒ׉8QűTËjx`;jKTVJiNI [jbp8×#,*ˏeָ~yҪ&9~"Ր=WR,lǦ|!VON\8=qZjU*fKT)튷\1CLPPfa[a*k,ScA]81­—f̠P쯖*1cN)lf­Z9(le`b]b—f\q* 5I'oYr6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbot$ LY]G5ml0\{c`kV,tscjA銻oujzb(I*x늬I(q6ZViG,lPjcx늮/\q*LˮW7ǣS A|w.]qJn_mB&wR+ vox1x`U.Xw*8ce8 *R`e\Uh*D]kDPZbIQLxRo/4V5Wښ⫹f*rqWaƒz *Bnk- )-3 Z⫿g,FUp+ ceJdcP6/O^S(!,ץ)4"-n+!F]1Jur*9]0*UJH­1U1W3Uebe8UNV*WN)TS*6U0+|銻]1V\aU6.PrZ-L*|V˦(ZdLUi, Ua/ZdNZdSi3q L8Ɠ.&]1ULbfL«L``ULbLaqBaqUV˦*ɛ%IY٩QG7UBS9H+ 26Zyn&ŕ&.'ȃ`yuvmq9$Qӱp$NI©힃ko}&RUE2VChhrȥylV̈́*q2JUptUզ_ I(l:zdT@ӯ}$G*fQˋn}mnepnAً=d@ԐgZ|0tFem56[xx*>t-,[;ɩWAE4L$v[Cŷ%EåQaNcOe $.8 G,1GYb;dĚlɫ袀aVpyFTiYaו7;W% [U)6*3b͊FlP3aWq͊LثWS6*2[+]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱVl Re↛/R9Wf͊+L2W1Vu\UiB:cJxuWkTf@YqCp9 ޅ@ 4d1rbciM5%]ZhرuF ˎH{"BVRޕڬzIO\Ğ3G3 U5M$H۾D$T5YzJOkeGIԝB#q^M1VoV0޾;V Xfa ۚR*'4nY&"L,xEhFI *6F(z$Ƞ)djɖHƤFÍ32[0JIɶڒ?li^aN,mFvpÑ mL6Ě"d|]CSL)ULm qUeN*7L)@6Gu`sLDkjS  heI j́\rl*تUFQđ`V;OrfYu]y\3쇨'3y xEP0 S `ZW u-U, RVs 9% .9{ث2yLPMVP&yx]\*.͊/;(⭌ثlUp;dJ¯5q&Og6ئyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbot$ LYE._9Ҕd٤,/]U3B:-FseXTeVR;@S (w=AZ& WY5-%N&VRw%0!LKLP'ö/”4Ff"[Zol mVq6c iӦ {f6w=1f~|*Da"ʗEmM-b.$]I#247MR";BMWrp5XjS؃M ͆"ѱ,uJj}dT\N8>/{6>]!O|LPUO#_GybjU´רԡka 7Z=EZ"mkZx[͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثq튬9kq t«1"qʮ*a[8S+k͊-\1tW4N! ̵u淣P@ԏl`$8$_opmq8s+%]N`k mp?İ̭$ezlyn7E8d$)mVхk.5## qJ|n(]ӮDI=2l)\SsPk)Xю)N*mPcFh1lL;lXUYx~Z(Lj$` ʇ Zf+ABSu+0VzTBEqUloWlUsF(\UE:ej P'PPqK|:3VTWL*P3WT屯L Vs)I!+㒵Q*GLI֦DE>,mA) )Vfɦ*L*6zLԯQ '4•eVnXȫƛ-kC^PL*>]?%ޟ#3A,WϚdP# mydQY\f8\1^3TC\p*xӊ h*p%Tf8LUC51WLUc.EjaU L,l*͖(Sf81Ub6 blRVn8lpmsSjt*_ثf1U8&*8Vo/ڥZV;}]m#E(M,Pԭ+_U[GV%?6O9}^QeLɶ0~'s#7SZM!ӣQTcN UAc|6$xLN|`^jcj\Vծ,(qR79dVTVLڸo