=ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:29:18  &.(6HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Ba=3cCny 7*[hwXv|kI| _P{Y`.&: ۛP5p2Ik[w79CSkǷOB9ObSVo`r6Mg)g[x-eln/9&TyFmu\g_g`ƣ [Zvm;}:8=%J~Ic}Nʿ/O!HcS ŲI$BJtR$$I)I$JRI$3iTtLgfH]W8/k3:B,h} |5{ܼR[8-p D)qP$|S~J/%i^oUS `ɇc }u1P?ŲV%tϥ[ju;X-FAJI$STI%)$wW'U$}ߢu$S 6/o?1ߘ׳u?0O.2|Rf\{&Yl Q]|K_ ni-L."EݣK+k^p8%Ʒw7U" s.Z}" Y8åIa졢͓} E*9\R܇DY˳c X, }wn?][#꛹}n >rl{=p"u.Dn7-ctS(0U$ƞ_ޡc/ksLg1 et:h9iS =F@В|8;W X-nEzltLkLZOhI $I)TI%)qS!ua,oXv%u&3+v=mqI6Lq$; >%\uUE0A>%,Zbt/p?jղ߅2rkw7@2?e}:aٓeJmm▏HtDE @OO?;'|',P[[{\9׽AlgI1FgW{4#o JfH*N/4CKF,wѭA ӭ͢UmC`pqjwNNRM'VFCGGZ5۫|~n;\ڝ;?"28F/H-Uf[k>n\އ[K3xkr@>/U#_6 5TZ\\K׿]ϫv?[KL6W[7TW`k͍ovGeש|3˘r^pήuw`{I%)$IOTPSS$--pc˜`.cHdcP˚G>?oU}N֟eCOY9cDѰe9̓5X,CiLYQk"gcSn)vM??Yen#iIS!bt[6;2}G'{}Z&7DhH.~?_m,qkYfQl?Ǻiݛ){,h;Nj}@ONjawm[$Ǹ9i1=\o܂weS!Θ r~zu{9g"<6-󿒚7/"[!凒GwRJYsŖ?{5CE,]A9lb6nmMǸ sf}K߲X:oP+`ʇ}Y?Wnq/[6Լ9enM*5x #ΙPf:c5DI&%I$JU+qq72r\2~HOIN;\$y%˟^NkKocTU0CKeSMm]?+f#_o_ILn#he8khnipi 1mY}W8gT??m-.3ukl||AevI S"Kp0ȰC빏 -pgGb鰳s=Sh?cØOšgJcY}h7O љVѿcfw-P!qeG~^K_-m41IE?q}/aqM]ghnW]ɮ^H~obZ6ﴼm>/?ەej+{xooަ־+nyZExN,$Ws(99 -ǮcOU{e]xlOG‹-\_c^Kyܦa2T(~Xԅw 1 vF#:Hf6GW,'/Sd8w٩p_c;O|j8,-e{w{MnwOh29Q?*z6RI% UfK?5l& ARSF\V}}V FcuK۲l]'Vl.զCq6/;^D;uR0Ƿdco|GaG7m`ƽ h'q'+C{\X`mfZ_N 6{eѥ֛mGt5)KmN."]ѻ_բ_]kR7lPֈ'VfV^+mkk:󜒞K(klA6j,].<]Rfu ZBFE?'㵮Rcc@3I]~qkʭq>Ou#O>]{4 )7'g :7~v~|]lp;[ױ,z{kĀ&dEKITI%,@*DSVڜ@scO Xz /Axvs\?GӬ&7ߦYش|vg~RlF-tНIR\ 9S:CLQ!%^];~459+Se*owсVf79cQ[hl m )p;" G%ڑ ѓBtI%?Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU workbase_foto-15 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM  Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Ba=3cCny 7*[hwXv|kI| _P{Y`.&: ۛP5p2Ik[w79CSkǷOB9ObSVo`r6Mg)g[x-eln/9&TyFmu\g_g`ƣ [Zvm;}:8=%J~Ic}Nʿ/O!HcS ŲI$BJtR$$I)I$JRI$3iTtLgfH]W8/k3:B,h} |5{ܼR[8-p D)qP$|S~J/%i^oUS `ɇc }u1P?ŲV%tϥ[ju;X-FAJI$STI%)$wW'U$}ߢu$S 6/o?1ߘ׳u?0O.2|Rf\{&Yl Q]|K_ ni-L."EݣK+k^p8%Ʒw7U" s.Z}" Y8åIa졢͓} E*9\R܇DY˳c X, }wn?][#꛹}n >rl{=p"u.Dn7-ctS(0U$ƞ_ޡc/ksLg1 et:h9iS =F@В|8;W X-nEzltLkLZOhI $I)TI%)qS!ua,oXv%u&3+v=mqI6Lq$; >%\uUE0A>%,Zbt/p?jղ߅2rkw7@2?e}:aٓeJmm▏HtDE @OO?;'|',P[[{\9׽AlgI1FgW{4#o JfH*N/4CKF,wѭA ӭ͢UmC`pqjwNNRM'VFCGGZ5۫|~n;\ڝ;?"28F/H-Uf[k>n\އ[K3xkr@>/U#_6 5TZ\\K׿]ϫv?[KL6W[7TW`k͍ovGeש|3˘r^pήuw`{I%)$IOTPSS$--pc˜`.cHdcP˚G>?oU}N֟eCOY9cDѰe9̓5X,CiLYQk"gcSn)vM??Yen#iIS!bt[6;2}G'{}Z&7DhH.~?_m,qkYfQl?Ǻiݛ){,h;Nj}@ONjawm[$Ǹ9i1=\o܂weS!Θ r~zu{9g"<6-󿒚7/"[!凒GwRJYsŖ?{5CE,]A9lb6nmMǸ sf}K߲X:oP+`ʇ}Y?Wnq/[6Լ9enM*5x #ΙPf:c5DI&%I$JU+qq72r\2~HOIN;\$y%˟^NkKocTU0CKeSMm]?+f#_o_ILn#he8khnipi 1mY}W8gT??m-.3ukl||AevI S"Kp0ȰC빏 -pgGb鰳s=Sh?cØOšgJcY}h7O љVѿcfw-P!qeG~^K_-m41IE?q}/aqM]ghnW]ɮ^H~obZ6ﴼm>/?ەej+{xooަ־+nyZExN,$Ws(99 -ǮcOU{e]xlOG‹-\_c^Kyܦa2T(~Xԅw 1 vF#:Hf6GW,'/Sd8w٩p_c;O|j8,-e{w{MnwOh29Q?*z6RI% UfK?5l& ARSF\V}}V FcuK۲l]'Vl.զCq6/;^D;uR0Ƿdco|GaG7m`ƽ h'q'+C{\X`mfZ_N 6{eѥ֛mGt5)KmN."]ѻ_բ_]kR7lPֈ'VfV^+mkk:󜒞K(klA6j,].<]Rfu ZBFE?'㵮Rcc@3I]~qkʭq>Ou#O>]{4 )7'g :7~v~|]lp;[ױ,z{kĀ&dEKITI%,@*DSVڜ@scO Xz /Axvs\?GӬ&7ߦYش|vg~RlF-tНIR\ 9S:CLQ!%^];~459+Se*owсVf79cQ[hl m )p;" G%ڑ ѓBtI%?Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$dNNM<R&I %a6UMI4WI10IoW[!@R$㳗!~ۣ] h4oW tRYxN:9[~PwL0ZRW oؒ:9X-[~fW+:]f $$IW>ۓSuf>J#$RTƩ[XVgU}M1Iw RJFksTwv xY% UG pKEpU%8awYsa[_I.x>%h:I.s+'փ:ֻNiҽ#쭈3pjBR! ]%ڤFOyuz8 ;U6YSk}T z5ݎ%uV>3 2ԕҟDATZE;i!sn"I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I<+tY *ekv$TZ4 O5o]ܖ$i .9^Owܰӆ+ZA!t866@o&XY[qh'UalƲ i%YoFsw/Hn ٘ pLro ?ճ^ޣuÉEy=*mG+cLI оJݨC<dV%B1/>Rƍ:\L8: G fh%uMƁ.D=G+[=gSvUϊC8.9htjZd4 Zʙ@e/L-6{7_dֻ, RnJM>!$n}RS;W<덀z@y;~gm%_5& .$;g6_ @&%bz>ѢzT ]Rv* qsUٖ r@V 6ǎ!;uԦ7z{U;qxUEԻWsug6?:*s9x(X5́/8jui-q(QUz8 h0 ٯtT'SVYYw:jݐv9(>ą\:N[XgLgNND8k `\ /` NJQ.y!Ykw`jrNG+S:ĴMuG\g bǵPVLX]hC]Ƈ ڲ@@GbI'I$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$t5hUOO}n0$T6\a VY?r7 [),?Mڈ2Krָ%cϗ4-B%SDʥ՞~W(;>nЂ2Z6 XIhKwH nNSy2{#3?8}R O<4E>Z88%VIyĸ}|tmn^0%À\IzR@C~EusD=ژԩq+moZoF~L6טC='yq3)fO.*U%Z4L{<#Į󂉁1Ḫ]cn|%JzHkA3WL4JvU.͸D )13q+=g*"K&=NA?iʯ96{B+]׺wQ u*C ԒRGz: d%_ZȻgc`p[ӷkZy\ VlĴI^&af8_lr'YX%Ge쇷p}^<0?N` CW}(P^߽lAͭ^nεue\/8cDV &^B[c$f]o V~GzSlȺo6L`XŠ`$x5 -t|xS]g;ZVuQx.qܰM{ GuZf“(P?7VG K,s~qqqRȂd꛳C dp+.p <&9p;(v850x8kDj1"Ӻy VXUpnDc)z"U'-Lkn|S\7eVw x lAʁil*Eh%%ntfZ\5BZ>* ^ѡHQ LhRǂDt=Пclq?Byi>OsP 4SeQeAM(o䐃n`y\xUfO1pd;'0aPRw.OnAo w䴻kG3YBYw0)TRK`*t*mi\4(y=GcP{'R.!.ײHl#I)>%Tvw$4 66Cpy"&+x&8(6'2㿚O. 5ĝtEMlʘ4T=Yl +5ņ@aU0ZNldרt(cvnnA*ꏱ'8w ˃iQFcVQReֵډgHKffur3 H{#j@u0m-{*,nyQeC{' 0撛owW1GQ9<uN h8Jl!\D;2؀I红3d wkJ|*[[7Q.u\^Xnۺ쾮Zjoi?Vo$I=RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$.0RI$7L$1g}\m-{ctICB J.F<ޤs=_\tːC4 K ZNZԅ{DĸDRLUM{sl۸h‹ tUm`׏%e׫$" r I\[/V 5'u@ Wa)qZeL Vg$\^n˻+#4LuEOJh6!J+c;1OiOAs`ۻln~Vk][CpTs\,8@~$Pl \JzO4 $#dNqxV1BsOVBk1V f4Rn!dhuR֗1<:ۛAqݦVnJ5QD+杣h:mgT8ޣlLڀ#XX aZ87w{*ർh ѠB'ʐS;Dp1n\K|8IѠpWWWJXW/`;%:B8c{J'9|U}Gv;K꪿g)9:a-'6TuN:YtxY2%@aNٹR7ur\D[Nk5ǝT1]yN+2Q TFd;'4=&ϗScۏ"uݧhWu{"4Dop2?+HA p dݡS  kcq0|N8.q]H<*涴$QLSco >hf x)ٹʨQ_w;yk b֍ :iS9.J uv yn3I6]8?! 2U5z (ړTq&)k6V}u4?O*C@d&(&mB` %.`Sk:i"EU&IMDn;N2ѢOP9:#E]kKXRC%3,jtXeR-RLAplxW5-<{G $!2<O%?;S$NC;lD*U<0ϙLkL5B.kap}X?I8;YII]e<@ѻWGv滊Ğ$݅ĔlʙhLj.$}UkN7<߂=.^@™h:"JPN1@)^MY&Q(o!Kӽ,0J)grjRSuJ`8NAVcgr:&)m@RͻlL]CAEiF2q;kʈ4R.hKufOvK =eu:\$' q !9 , @Os=1㘞ʻ1dkSK4Od$3+1;% Ǵ!2;];>F@1[ 8m $TV!ku`BG@ft㺲A)DtZpZX}Nc@gpumNcpqGLkkQ(VelݓlyDnɀP8!) +\:!%7{57+:1XT[wL: -!xEyaplWq{$vQ׶D蓞+%"SVNOjIK旽Bg=} b% >3X:[(y8Jm7(m뤣~/Y%Vh`ld7T^Sgxoו4:\O+#bW@kZ ,n)qy N^4o}_γ |k  /ȹZp)\(H95#ڄ$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$:۲~=cʫe?C?=_ޥ+(Z $I)g?ԗhRI$Jh%g?ԯ$I$>zIz+$I$hR^zJI$I)g?ԗhR}}Vn%$I% 3mKOW^L\0I$^zIz+~?x}ō:>I$3mKOW\/kHOI$I%4} Gz3mW7'I$I%4} Gz3mV,͢\#^׍ $I$hR^zJI$I)g?ԗhRH}V~I$SSOW/C?=_ޥog>ȏI$3mKOW[YKa>I$3mKOW\sؒ*I$I)g?ԗhR^֐ I$SGOW/C?=_ޥyzN-c]\I$IH= Gz3mW70qI$Jh%g?ԯ$I$>zIz+$I$hR^zJI$I)g?ԗhRI$Jh)t2hqXKF}+-kn*qgO $I)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$>%)$LDZ+ú c%)$Έ+wF~C?Cl]YX  u>Y$+5 ci&$   \@VݽDdYKx3$s3XVa:題%HUYP6:CJ̗;#N`FkFdaO'[c-wm{! Oh2X)ÿ!/Y\j8hF!KI0kocjUZrwKpvr&qt{Bx%De"=u:HxO  hǦ]BvDn(Ug^@$TyqXD=4'NT2i㺃25IüM#cuѭP@WmA&}ua!Zw@^`\8k\HǺ 5=AR!ĀPJ RsINCVhZmo۠֏L%<D&/U6)qTh$mM9鳿ud0rhpچ^^o5Nc|m_5_5 1$~.OY B $jFRZUdI$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRI*Z^o-|I$od쿱mcAW/.Gi?R [SuסI$Ͼu̎0r87=s\+!絫KI$_Ul4:X"{5&.:y#rY2M.Đ5.]ߴ1'vI$Jym_Cd:MYS6-n?6Ubķ%Bk~5YFI$cJfKڴ>c>55u88uaP(ƍ<V5ʃ߳o$I)~MB܋EOpw{*滋t$O/K\oĬF=//bI$Jz\eTՏhp"m0?k?ҿҟI$IH}^:N0i=qwukB@=;BfH5s$I)?Sxek_:g]Z#G@v&#R}7Jv&%[gSI$StoM{`ffVs,Z@n?_ {qk&A1r~aւ nI$IM$ov?Vbe=)a'3 tY3&S`<G^KIþv?sZG )$I).LMcR^,_>L>F8^ԮuZߤk\I$Wfu:a}OW}UGAx4 :=;۷>-/fA>M V8C=uA$I%3d6~s^uj3rYS0-xpoZ4};3͵?ԒI$$I$IJI$I$RI$I$I$I%)gO AgO $I)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I RI$q,v *J$]zMx7Rp3$q/?%:,>cPL.SDl+R <&veS+Rm &Π,TMVf Q@F#@)BΧ{O$VPev'yc`(b1:"6T2 jJ[&q@){tnbX@1ZَRxr ~oQ@:)KΜ%jo=ӵۢepD3+G)r;CY&t }SvMn*uKaVFjo[qh 1ݖe-p} O@D:敩ѹ8! ;Ch$3(LnƖjz'A0tP6;QVcPyFsi8iV5?Uf jVK]8r:ꏴ9"8AN{_!9NH,UY6nbTE3 6J3GQvlJԑDzVL%J)֓ Hĕ!YpxEq#mnPHiIۀ%݊5Dd| + ,rZF 9,süI"nꝭЩ}& -$-7R4!5>wlV=%0ֿFTEc\pArX g&Cub䑠Bs@QĄ(o$1Oemu:.,tNݯ(-U<ՠdhل--?4gXĐ$,Q^50^ BMcQA)m7_r Lܙ`#BKgrH6DKe'(aiX@gQ:*'  kʃ\ kTXSt:I\݄pG3M4D!΃P%I#nӯtP# w*UXKZ@*p;q?pL=F4;wΉ[JJ^q=ij8hW V6D}\_Iw Սr] _LUFҵ빖Xd/'B=^ÎqԻi-䅀斘:")+l8}2I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRM#"$I$A=@&g,//ݭ$I)yՏ^}z#?7=^V0.d ԱNlc}:cwĒI$Cɪ+c.l;X/n2.7˛eƤI$?`M(Xz;cshCo~zUZ}=wws}_b׏;lk&96$I$h29o?JX|u?O0Fm յ:%ZVNo8;_I$JOԨp-"N6.V?%PCP"G[V~Z^?N_skt4rI$Jtz'M:Kg=,I$INoLҞ1C 'E1?mO$ӻoI$}M]VYTYdl.i7Z韵q]f=ѻGؒI$kETxl$]k3(yIt?O^m! A2I$Jv>uXa5y~ϫ7u+s2o"'u|^̂ n?Ź^%M `$I$}'i\wSncwp zԟ[/Xz2ѶvoܺvI$3w z^ikџZVɻ1+w \E_ 6E71XS.afI$٧.Ϫ.5' 's~el_O#U6f Ԛϰ??Gj@$I%.I$I$$I$I)I$I$JRI$I$'w'wI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JK9W5lxht+l"ԡmS Ac$7ckBkvR8,QòTrfXyT]{X#DL dH;[<)FR-fGV\+5)nݧtBNfIHW~D7wO^PsH?HJoUjLhy|RQsuwtn: Lt47)!>0-Rl Bjht|hupE*:ꑮxL# k dܒR9 iVWYS(9H N1>$BIO뺰^~w3 ^\(mx);qAz|q IAHQ!s~Ξh1 Ph']xBo"5) 9%6&eM`h|; #qezT AЧTv-I77@TQ*XѪnDJ*tw4%F溪O)oiqS'a%0.v 5DP ǁh ja9lKҞbuJ=kx`s &‘]h~}ȬeZ05AXRcs8˕a{UŽЍ;U-k+@4wUc|J$4[nVpl5rXuB N1sL[gN./MH qI$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRI$I$gs%?y]ާV8}R@!3Ibt:Qnc]ps\7W͏J}xYm5 {COvlĒI$uN/h ]Z:f=njIX"Mmu;sLү{mgɳ%%No_پI$cbOm>lYkc7G%?t}"AX9 #餒I$lد92?vٷz^E$40Uް09wEY\m[\v1gI$f<} E\[wVƢkAn:2[sC7W1Yڳfȭ&{=$I)9)wKw3vgu, = <~6bFucdhs3vm3:vvks^}_wRI$S11hfU 5N὿͵OQ]I 0eo}k'ֻ ^Yƍn6ٱ߸FH>̗4憶'enrI$JON&Y}G7CZC2En][o?5_S/mNs1|7'I$ScU粧Kv׈:9?d8綽d}RvK{v=֍?廕"I$JjtԞY4Gf:>`dX)sc=T>d}T{_4'~wI$S/v1|Z = aeySfX\Xs/m8. LE' ?tr1kEEhI$Pys' ?lGUKij'RoRjI$Jz\{ٓ[nc ﬘ o&Ƹǟp;vkBqã4İvY='(Q)/6kĒI$9g{^85V۩; .jU9MˮK蹏ë"{$9_i$I)I$I$$y7WO:F'UO9]VΏnV8,5cv_bI$JvC@ R\8_bicMvCGפֿԯfC0旒Cvo~$I)IfnK`fE1i9n֒I$JRI$SI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Kc p5@mrWBAM,Fl*9%rZ+ ZGS}#68VҢ+>p9P%>tZ¢9rMDHni>O%-{LwCc@>|rH&F15%Dv)͢G ,i?$CxII`egh .0|2wUiIhԟB)$}ryAIs9 ''lBb;Nin>eb({u;S;ۨ"-%'=%2߫[P`OB$ϰ :&9R 3Iw 7I%&Fhq5M[P{[X!)-OӘNb9V Sfk-4GU{,}* IqveGnjX78tAk=0yi|DfxN恧dj^FyT.#iBcX-1`*MDo:V3;sTݽhiFLRZD#(S"ڃ~rpɄ/`8j;R$\B O \7Tahk^wNćA)j4!3#@7zf5Nݎ qO[_.28)l<$w.$I! :! :sYLGx"Dsd(GILk>$Il.5ݴy NcӈBY<)< HbDCTFC74$] $v롱 j㬢DhP`)oԪ]}28KT~#M%E1f@Lռ5!㵖XZ]:LF֓1WkӳFKI$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$ELy>n?0bFԜ3Rx`Bq["Rh$HF{>>AX&$hwtA[@1ʓ"X+pxR}qhpP81mzzTln0LE:9ӒY`vG7lI-R%lۅ4Mځ6h9MJ|FU>Ӳ&3mrl`jq dIrJH΅%1x sk[^Jkc#,tSuRpݧ<'7Xy{`Uт ʳQ.I3,h;ɘ ΥhtILr vn!aÚ\hbU*SL27^L%.  ;cL] .N d(sDT$sT"Nsm(uvkH:tiIF@J"JJYX+8-{kB~p]hK|R2X@J! StwM7qlumnA;7 a`(בc ?z=v ġt !>x%`$nsZkp0uIsyT9K C ʑ j4*{EƜ#nZMdI<k'-ؤ(Z=M mav&{7L?W%!Cf\{Sny3Bǒx;) 94EL i*4<({d5{Ko LF#p4w T7<$ߔ (]x)퀅C @Gar ] %;HJVn'5PȨ Rh8LiSZu cТYJG)t! F$H%,?gd7ap:IJaM J*k-kϴ{-OA}hD;0'G%%3u@:ȬD(N1*,:HN[TA*gpphΉXNNa$I AKtH %! ]-xGkm$K'@pcpxB'\pSEwQ28?SmùD)N`wC8@hT_1ȡjɤ*%3DÃo!v95=AJJt[C^6>bZ0QXKCt*@^pISޜH=Z:IOs4[8`;eu\6eRkplZTus#Ǖ\l\ÜBĴV>Kz m5AUWa՛{.=Jd(V6և7>H- Z$I-RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$KG&l04|?9knz8DA%sTeSK;'[?q{9gR?&\29=R#dIG/ 7l~+Xjn^vÁIO_^<ڗ?Ee1(3ԒI%ups#P:;:3sh_wȳQ5v~H9?ϏOsPܙa5$KKH?oU6[~Zt7C=YU~ߔ&/0`Ki rI%?ʺN٩{2ۗkXlwK`ӢϦw|1˖rdG'9-ћq}!]/֏V|g&\B0ϋpJfJI$-6eZZU_r%q^[\Gܢ\;qˋY/~uI$'0X掠Rtݍ꿪Sַ>B|ΚNֻkK&{F?@RI$XY8sH?i}d`n\h?պ\R=i}bY@ց;=o?zԒI,ĒIf\u^>;o͞Fo#1Rّw1`@LŵN}Flρi]>W{-&ݩ%M e II=ǻsk 91{ZHZulz_OFpB^FF ǥۉ2etceUMm6~6 3'zHv8v}W\ߥ]~`;"`c9\K|=V2i'n B-\MZs[ X[<W_ Nw!@}8εq)N$?⑅e.mcpi Ec}avbVKƽc#ZI$#O_[Y҉uN{w~m:b֏FY]3a2nc\kamk:Һ7Ts;25 I$ ]m61 r??#?+tO $I)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$RBҙ*y%)2u 1ȮYSGZt4 GܯmK0yΧs_kΰ5~eme%RJiA^Qre&H)d5$}Dm5V8~jllRd(J%tUB@k|U,t M;%A[rv>v ʅsaQan@脥5$$ʙdpRS33pnCl4{HBeIQuS S 䇒V}zh;)z#OA 6d@4w Z&W%3>|":I3R-*6\(pk '`:q.05IyAJXj08^x*6[` !  (8F$rROQ;x`Ԥ MX;UZPݬƁ@y(w=KS\u7{d79-#Y9`S#BwLH'>"5ILˋLϘA,q;[AIp;]<'=S62w}^+edžk?E"-r J"!17mxUdVZuQ9u$lPХu )5۹- ;VL8 T* ;;kɥ.iGiݦO mX.6 ;(4O=Wz` 6Ǒ;\t6Rk\ ԩO!Xml`kDvY]{|ZCHSJJk{a5a):l QVӷPTltF&Zd'KRlzVML!PFFō  b;$>餰d8oII2{4h7@4N+{jpD2;7uAJuo-pVIL] ʱi52ӄ62Lj0]))n`nGfM EkD ,)s%&k@$D005P[SӤ(7t-#TBqS1q-#I=:hgL8<(X)?&$z,/vX$iD\lxDkEs<МG~S&<t QR ]IEp:j{MNT\`Gt: A#ĤHI)jfǵgU0j:hs =$\waޠLl'TJ2=K U"ISsC,Ғ4cf56R>#b9ָ"BNsfy < GFdž 2eN 8q6zL]ns jmx5t)'VwmM3y- ddvxO;(ELlnqMWgZAtK63)}@Rh`I'EwIKku{*459 r$)JMTDZhg6Rf0>)ĝN J1u0x'3ܤ4%3J`hNn%_o%8 &GtB~F'.-qT.i y5Q>I)3ȓ(X-yRq3Esm-#_״[)EKz̓#"*M$PE9-{gYRmD (!༁'DAQ:jκail;!<@P,nc.&x L:I –3Z H7A1TΪ$J*gYurUjۧdvhςZP͇Q )d 6\!aeZe f%8lU̇`I$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$JN`D|>ڹm?vzIHyR$}ʣ,1YI$KS1VZIO 2xI'cASI$G Hf$?Y$$c/L? FI-S8fZ[]/7nD֚;AR}7g8a/.LIF9$3pGzMlSJ[1YyFMA |M9-itڞmi/&6꣗ϘpFQߕX|X4{IVXd7&.=dWr+﮶zsE`Na֎W[7c}ftoVb.F-خ{[Z?%ΩŧoTYsO1gp8VxD1sqZѡ,px1,p/oWG]'쯯wn31,NqͲt"gcߔHG;Z]%^-ָ[@(3%=xcݱG^m|l M; q=0[mcÜ)`? k>xguFgs{ߢ]CwS4I?%Ƨ{in}s3¼⁘tj:&KSuow0׵93z;noZ deߒNecO/s2f~1blEJsoɥ4;ʩ$:I*mI$0eiu>zbͰ陞Y$3N"j~q%2|I$E~-8-hip?IÌ\1?,nbuI%s;:~4"ηf }270GUW`^qX}~2{G?c$b( Z埝եwi׵ǹ?ՆI2JLa{[&.f62Ycy,\.+bWQ0ւI8CRܜW*tÇ$P2+'c'̹wnes?Ѯ$I$N7&NO/1E>OgzBԲz&Uve3&U{ w}v[Gd9dzM ez~(gSK-c\Bw%$IM.r=T3cz6sf'QvLxw:r ݏsZNj }a2P~ 'ش?3kqCn۽̤I$vًY׆j+?HM>[=B^ԾFUxpXG o$I$,!h,!$I%: $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KS{|Z~KcIW1CֲETP` {*8%DYS><LJX]Pc%f%k$xY g&)BU]`*@9 a EM}sBW#48*x̝{SQy)k?)y(R::Ц `Art*/"\ǍdvEq&^tNa;7I2ؘPie}a(li'̹s Ep\T k xpQY!&H;tDwײZFSY&$"@ARO!)AH9k۪kG{ƼhxG&5i L;#iEH-s4O鼰!=Zli:M5Thc]@)ti$Iڍ/NHH̄&))om#nZͅGkK#h|ku:US'ְ+B'U;+lN>S)#AZw T> )eo#H4mU\SfKD2YH7U AL9%3`-5= ZR;o$}&B:%E:"iiF&NdnI>bd蒘sHemp܈Xi2N >iA'^䔑P;jG, !\{!}}'q<(b4JȞA GdSf00ICŧ`uA% %Zk==ĥV 6S@B*GYsøh+KC HMPc3 .uL3JenSɃK9Tm hʔ)JEāah("]h-#U[ & Z"{<Ӄ-M0St̵,9m'c_fRH<$`ǚD(9fIŅ() JA%1cs<7Y:: 8)C,cKwR4q!.񔋥 5-Kq.)u`NZ ISUzwGSBC Ƶt? xN7ijm( wzi>(͇E'Xti|i%%1vTޜtRj$ NE s"4 9A:XָZ ڕHF$t4F)VZn<rD{a4뮨 (ږ=]i¿4H8&ܠ!Zy$*:;ktI$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$vc]gVU}c+ kX6Zl{ 6Xxo۳CsKd#XXKu}s 9uquʺϨjƦ}ou] CZN>_&&+?IoXYpţcci[~ݟvUQ{=7?>?ۈ&#R,$ﲻn{ꡝ=7to}bG}5O89}#-3[Zn剟/ΙF=ř8zoCw+>M_oOx&=e|6]΢a/տkUӍ)5SUӸsB|nU.[퍷]oWv+:OG7Ƹ=ɳt qzlm]\O:ueQZ/Զǻsz32XGtsf>;kjXXzv]ccUe^fG+꤭ϭtpN5tT.xណ=[?4|k~OcLnݽF:,ÜΫ2Y~mA.K7`я}W~՛?O~=O οj,LZF8)音=h|nwi˹PY0K}vUB}c>ƺGYPLͿwO9P;]]>GsjaY{OR0q9MhcY3MeY 10m>b !re"?oQneUC+D_tsOֲ7T2xw}_N{E&m_xn?w֟Qm'2Sk ׽n@gcK.-qlloVu,ۚWi$칞WUL!ռX\h5>ufe 6nȻYNC]m p{o. To SmXkENق \GzI$CI$I$WbSAynht^mǷJNyb8PaI8 Q8(C*D!0/q/onU?H\ѨE\f1 @7JC9o((/}R ;T׺[F)N=s6NŎNcxB"G l IL!ù g#nB=pO@m.Ič at"B*e]r̀>VwX㴢\xNG Bf#U&6AܒSXx"aú]|,kh"yv?eR5mod '{\ᴏpR}KTsMM&d Rۢ!J|6u 8y*9!>\^`&8HEK lqQZCU.B글j$i Ӕ%%4rU^u>u=&])7SxO$R<Үv _> HnK wEO!`c'UtfG`hRHk I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRI$I$H9aRݶ q`a$I%&Ibas7 >_ڭmI$$NFVؗ8v72I$JRJ\+u`.qk}Q&[[k8okI$IIRT_V} [wC 5ĒI$33h~C5ygގI$I$I$$13lk}7?ؒI$ fgS5k=$I%)$2opoI$III'.@^5WwI$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$,!h,!$I%: $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ѱ>poaVVVavI=]#hh"w0q6^l!uI\nQq/2dF6D)4)c&:pdAsų-h_R{K衐٬r=M#DFjB8Oƨ!̰?fH1(sև{x*[Сjq$T[([rO*ݯu:%=ы|@yKYBRO:"SYc\ {`ƂLy]Jm*! 4n6Eݘ" ;7;x*oykF$L# | h,.xt>IeT~Bcl LGd)n0ۨ.*(a\I Tl?q=M0I U4N xAKŭw 5&`~k1;R-hk> 'q$Գx '&qm@ &%81R0O e 24ILCMsZaTko5X8Q.vƆ?>o(|E(x."8kIAB4*7C&[Ak`9h%%2Ay*jTksky#rgw H&⶙NC%D+Z:$^3b\9PoRݰ>Ԕ_j"E HC{}Vm5z[K*-886;>QRmxhQcj$[,Wsx -c`N]- )'Hk3ka* 3 9oh)$VHPuLk&zp e !wJD))67`q }յF}5ftӄ 5N #luu V5gBֽ?"q{{I@=p3JAQlƈ~1 {))Ui{@L4!ۨL%!63Z=A{ˀ읍x%w7K@(k2cC"1q WǶ 1(s\NIhU-*/@N@AJcC;asYA&ZtH?zrdKTwR;S?TeeiVEAHzV>pթt`h;(8D Ik5-a: XU\%D2^L|x@t)jhD$c7u5at|3!*rS,42mI,H# a3fS:Cp/e^dd3-ڻUW05Ԟ@l`JGEЩ]kC'l@n8Rځ dI(la}ʅL>FL=G H.R7w!y[?HF=R`IN撘Lk@n> )znmbG3 "{[+nπD cQ ANIIꊚuco;otmk*6{}^9k)$chP+-p<&}u<OBGRI$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRI$I$I$I$wt~b11;]kq1YHY^]=lݿ6]2F%Q~~-.Uz-"zI$IM_u>` YW<gXʪeziN[w]gVUZU- Fީ͹g?4u 2/6=_ߊ]f5oo'=DI$k?׏nC' =,OJ͟EvXdNƶ׿sES[OK[=OgJݟRu v3юʿEѿ[53Q:2I$JxOJͻ.2kIh`nCk>ϳ["G7XoaԼ8S>GuSţyn WoC}/8eoQeiuw9λ9'zI$Jpec?V5ms=OTO-љeeʬmƾ?{I$WZ31򬵎"6Y]fvw=gd[깾TeGOW[Eܳ[l67'ޭm5_A~Qjm&YfC2]g?թ==zlI$SwU~wLĶk7K]1q~:~uC )O=j\[u]vWcȵ[]h5f'K+?S?z,JϩM"duw:`peĒI$XFɻ/&۱SZ+Rб+ӑRWgu|/i- j{?M[ѭlɮp%~{߳5~uYcۣwA u^ݟ෤I$(i~1Hl ene{XcgVyYc9FW6ٿ][S*˲nۅCg(sV]]eX[=zZL6qJ8I$^e_e_gx}3zپ}g^wVM5Le43cOzYoWlaluZ2Q$I)I$I$$I$I)I$I$JRI$I$'w'wI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K.э$?U M;9j {`-+믊3yʓƑm2Q\wj9AM+'lBڗk5jz-< _DJᬄ>=4<%5M\(i:4S=e7Pr5Dm i<)ۃKD{PxH(DwT8% i)Mk/[A+..sKtTA5fDHjRNL fuv7s}ka>U7ѧ(@RIt@Ng D*X7]9V5)5"Bʇ2W_M${!1mw*} !)AhR:)!eluw*~·uAh%%XäAݪrJIOm.˦Ւ۫-#_ahuUHX6)t0͑L *Y.'K: w;m$cPV:;$$ .x&!M`$Cݦ䍅Rޓd fPΧ1f+ikt+^wLp蚆6$pi$pSٺ5=[`!BR]ʘ 8{S$QD8Ц^,)q_=9A\TƼHEDŻ ORHII);M^<5P=pô)8h'K%.I# /)1GZlP`JbVw0>*-|3h +i <{7 P1JZH!;AS``vn @xkO*4V]*3'ӲOl ˏ))#x3 /5{Ě"N5tĂ~El{'qipLӬjS\ f1ǷT98vnA"";脜Z RSP;lQꃥ5m$P/9k]Ve%'f7b|SHk_ju-T^b- tx$Y.AL,kX!Bӱ6.v!ɘZIŴӷH*mYѢ>ɘ'XCm>IY.DU'7)-mK.0o6/idIP`=IH]ST wP70D{A ;̤#Bcƃ(i!@T K$74u<&|9Ha%"kou`E0(6k>1'@%FAv9n^ӪJY첣(m|M]VXv̏)FA0"t) b@Qۺ|8 Ц-4 )I7B~)sUۖE{#Nw L'I (wI3EI*6lk⁏cXYfӨ(ocDhJ4(ħALiqk}C @e>QS,`h'4IRޓ}͍4g=!!0;-\T5RkElhqB0X)H<RfͽA.Bp;y&pS"TlqA.q>F=N:ˏ KY旸k3 3)4d*KUd'E{-hCI@<"5ŰRR CK;^>iH8H7r@~ D'))g|sE8&ԶG) &ӝRR֙(idOtYp%D'P]#PKsA;'TVèQH0{&.^ #-=C` Nf(;e]U6=Bc].'K+ J[yFWRg#T6-p‹.t pƚj %i`s.zaPDt&;$JdJFy$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JR\@O)([micĵ7m~ݨj{jg1yI?WrW ܵS*LՆ e3/fpI$S]*s^}!sug-ݳGzok_wr~gNuo{$<~w}3 !zM??+G]I$S}afN^-Zc}+_oլ^U9Łt^{e}߲/^=nf67ӳ"]{=7\BXY 1ُ-,vzI$J}g [Gzok_wV8i N2n[[?ʫStL<[0=#}ޗTSz5gs}MMsZ6i}$I),5@5`?G~v0 y.^w|YV;kenoFڶ~;?YR뢡թ\@1Q<1SXOO_I$J}Y[ pka~ z*} 5umߵ׬-wճ'-:ʟgVY }fOz$I)w=ifkoA3`Tl.n[;_T쎧UAg7握#S鸢U_ hNSWSm1$I%=RGzXdZ05]Z>]3" %0Mwqp \,co}aя #SV7neكoٲ*4۷;}{?܏DI$?Z:~N =B۪Z7k>W+u\},W:N쏶3oҮ9)̽nvC{9?Q[I$S$I$I)I$I$JRI$I$I$I$,!h,!$I%: $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$꾦շMW=YqcP{&KvX`s[KgsV 8ݥs4.Ո:{ 5GW96{aֽޤu?QudƓjfn`yvD!D{0D$s f%+9\lV\Ak5U[쟗y$x0/ĄUpׅ {k}ep 9Cc\i\Z')CuMXTCVC>6yNzqS`)d8K#4Dk긂DKÇ9cKd&sHjw@`leU&=o0w)!vQOd%2qq1lH?f1J脶SBg3qڕk"LɉOMttȈ@hy R @-cKK*{-`NAKTC$8=x1'I:9'ȈL :8mIILhs.x!7GaޡU=gq;s&#T )y+jeJCL;6<4m$=RZw]y36(Qi@&u꜑"{''BJK d84d$.{L{~)?X25T0(O# sâ7Xp84 e| Jlc^LCwU9հK4 $# \m|*$5O Tkx}4>(꒒{D ԕ ÒKId<2V}ȩg4ՠ=sƺ.ԼJ`2ALf:he3݌C]nu1.mkHPL#Kw{p4 ;eMY JfLy풂e;Dk@f9+GIO3o%0D𫺐:WmR7;~yQk C@1:"9 o(mzv\;uj[; TIH;lRm \Ich9!%,/"%I;+t83NJD@I_I%"&.%dze2}-|R4HDN (u p1=+] `B(t!UR Ϛ@p'A3l.~*pV%%f#UTu{u+Oef NLq^؈\ևC[4\ۈkYT[-,`Ӫ: Kw|-]ϊ-`V]tI=I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$>J?ւϧR"I$I$I$$I$I)I$I$JRI$I$b90Ymmv=c-mn`sC欫wo:I$I) 1)5{@{,o1 ' >EF]ݏ|n-I$JM K>ѰzvU>Ƴw+$I$7B1, c@-nWa850EdM`M-?FI$Jit|\:+1m8r+vks]f=$I$:mƤY5moleq^+u5\fXذoⲒI$JkE4,H}oG"ucw*u$I$ңZm!x;oDg`c]S GZ?WXI$JCF(shcXd =W]jD{ǪG1.y$I$=)mgq{Gk{[1Xa8>*cqkH?6VI$IM+.M?fSacvo'{ٷ~OƤa7ٷŠI$Jihpz>=/W9~(L EX[`in籯vߠ$I$ىMc_[\sh!gVUB# 6 2Q[I$I%53:NuC&hs[c=W[jCZѵ5$I$I$I%)$I$IJI$I$RI$I$??#?-??#?$I$A$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]gN0}'@wS%,vq:<mAytj⹬Xx[D@MCh#>ͮ`*Ky&d"H4ו&J j4Sc5Ϊhh5-,#pPE'Nc(x8kb$!vEnjyP{ɳARm{_Zsʑd} SW$fۓ:XԜq۠Af3M:OtO(%kZ@$vJR4a+;_SA䘃:40-c3`VX&wDlp$^xKdؤQ&6&AT0HKR#MIP+h^ҙi L)!U>.4qzXnCfZg]Pջy )\^DXvG!{JD#úvRSm/!14gh?y'N"O)߫AQp()L+)k;ʅ.57 4*/Fu.Jg8%6H&FY-La'yM2yH3Z 2Z:vEʠ;!8W]5 2AL O ƧvD{?\vwl/'ĩ l ut"Q<6~+{}#\I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$:ڲ~E,cfA/EoSFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyFw I$I)ۧyԺV=me z[̵\I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$];&x]'iyB>H2AU+n."Vs{B &Z}IQ/p2wA`lcM\8Rk|Tjm"@}^x!kt6`l^gP4DhHe&8L’9L qjXCw;Y4I$dO肑}0xԄ5 V+vP/bGv!h' H򖧞P*Upז!$5FJZ &&1Ǹ!IL 2*Am>0,>3T{'[%>[M:$ xsςim* '@T.cT'D%6&O0n9F=nk:pikRrNl:S1cl̓[\v-q~T{X ; 'kCJaTms#wW<8T\  D)I5wM 詓Xsf;gYcD+psKlTqM r;k-q6Aޅ[ڞ֍Dl%/;`%*CXIt'npG{ X$ T ďh:lreГ$sqS+ȠE;'K/c惶xCq&l6(3%QGс*hR><%1i¢KqyLXw[7?p㺐!AܥƩSY)Nq){x%$tNA %2kZ !ߤ p_ &jf> 5ɸ*CTo+k`)a β AGqKD{LXΦ! ;q-{w)ONRRKӠ@h׾HBa8Gt7Du(H>i)=[qqa&]vQ.f@o I tR VhC%;'Ej}88x$uH ڒl2AunegMTpЎo,o|XHFrXoJP#`Ei:2$_+&cY '![Hxku=Yv%[γ(^yUtϮI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Jxc\; A+ޮ3|eXO02G\]/'ۨ!JF-:0א:JQ&x4,;ck N;ajSZt*@qꝀpgCPkxS CLs he"Ƃ&{YF!{A!3t:jҢ )7=R%cLF&];m f)r'*^[p,װTөx(*}'U$FאJJkɓ@[\~=\C~Xia ODJg@gdm8"Uc2dhОƳq9)C(Ƥݶ1'wU:8ߣ@\9R:@DGw!%%+Bk˟L<;pq"s 1Ot%#o DwXd'ihB5H\\Ov4Ɨ9Yȹ =mm95ZA ju9RcCDZK`h`>z&$JCkdhTpӲ^#@RSvb,]R.0j6#M~].L#'ybDu`q*U5:Ꚇ1ߺ=;k6vzU@0Be:k.{  =0&12TncVݽ0m/f5NPR\ CpD)Ou5Æ*V$h<Nk}S{ hyC3nh'DsuRsՙ *N!I2@ݪv 0|Su,,Ou/Ph|Tmƽi DDN`AiL{PcK7=ahrHRRlNS6!0aeP8=7:Sٸ0~qx>S}䂗|R̉Qh'@Gk"Ή<5RI#otkk浬ht5 'HI(HE ϚcDֻ BR5H4ո8uMb (۔Thg4M5=t ķPv ?M#}S7B0ж{o:yS$ڋ 8O)mҔ)lgoI*G u h$acɣT'35=ᭀt)ݪIqTTۣڟp]Nq'S) |:z9L@%/s֊J{bT[B\EIK |S3])9Ukdw(2R9Hs Djt#CvIg@lt$L5) pl*vǙDB{nѯdSRILVHT}WWSH "{(wSS ;)Ѫl{FԀ09Nd`S)Gddr&e iH8 BFsZf<:=9T hsLBVg0 "J-?%ʃtwHXM?T]<#mAeIׅ&hnNpMTG< AKU[D[S`ߦPvGe=Ǻuޘ5>+5I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.ָǂWh`x v_ \nZ.sX7|d+`5JFevT5+B d`fIkQR>-8 c\#L^SSkII(Dz6x.;{*7:w!!dpמ5;HodŅQ$e݀Ou i/ht;5ӀFѢR `蒘YMu.LǑa$CsEe JDJ%N2[#%"n-dmuDD*YY`pU#&cDTq )M昞%ԵwTh;AS IM&u M#LI$c=?i׺5)KghF=?}ZIvIRԟ$ڹ;$k = ]s@[]awޜ85;M;yH)WT YSǙg})> ,S&<Tش nǚYE-:(.ih X 7mst=]dI$98u; :׵kAALA-R ehfa$>*|@IS!%>,㲭ݖ8V8܎cl;|4i%9b Jgi 7Q/:J]$p.O$IO BJkJ$G x65ev@'R Jr$ *vnH*9a ik jK+ Q 'JNK*hXѧ 6ΆyNܐy@McgT6C-%DÄ D!%3q.pImCuذd)VCKK ;HhhcIpM`D R#b5> @ Lx۰wQS|Tt<$2;Sp9R24/$ǔO%0 o+v몋(=LfBNrfBQR( LsIJc3hfKKDH1ςS)A <$&4F`I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.: ]N% M.sn=o5zP8QQW ?Ys<JtwXi0\!%NM*sm ٔU_^K;yP5.<T:q)Xo {@_0yN- ,2 M{ G yE!hIά$B:[CBcu T @IM\Y}wk(?;_4.a}Dzh`)h?.r5 [Ltq$ l|S{)|-rR}ޭch} xմ$%3`'d NrZT1asyL/ Έ<Dׅ&88H %=nR*N}3T%eMGwA{pa0;{#)3 [NqSA.kҦ`!ğ̩T3+3@9)n&tLrP I 2 v)YX;H׺c)c p 4HF e'jΉ5dPRJ@@; YЩU{SmM?;I lSIH}ݫOth(XRkI S8MYOdoX8,f{wQN4 ,٩bf( )yQ'TTm:a"!(~JGP2yIM44ifcCMc^b;a;HAH-t-SX0hc@=)`= (m)PNlKHS{5\tw 1d^)${ǹVxy V7Y{KtW&Wa~gW)& :.sWۺ4t$H$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.ۧ.vV8 WGu.z<:eƼEk GJӚ[0a`ur=jSw'v4Tih0F>}v`#Ȧm2"r~ ͐u5MG]-r?rִqdʠ1xTpʛ=d h>#ksʐnʎCZ<9Ok*OxSl)#7Ma{(SKd)̢ Lqi$մ: AOIq<oBXZ{`|]LG:q JH% +ǝ .ժOi'_;4Pu RR- i b %I e0h)کDϚv Ie@;-G*-$I>+#v``b$R<(RkĆh4 6Lx)TX@nJGJP.kdRqn]'}'q4GnMwDJJ@k\?8fQc$S Hia|R:)6`jݳ.$4Trv8X+p>J9׫dvL3A ^ NR1'4AP`$†*DAN"R"kI9Qe;\PDx)0$Jb`'Pc _Yxi5XN?[I@iLB )3%,A/:^SnI {' z[dD$.7]>i)jrǷ"9ΝѡSVvZ蒝;y1JZL$$vz!վ, Qa"LFU rNv@u6HRRԀ >NCk2Ϲ y eXH ʈih:F%&))k]CCMZx(7Ā8Rㄉ)`jS X<<< Ua.{M4R.u)#92xILLptN5|(-)0h"L.*la0 %7Z4 cɝڐ%61IeNf*voqm`>) 4O智RRcLD eox$B_fN@'W"JZ9-?b"W qkxs'3ś\yKeNgsiW5A 5R &N) BgZcQf)))otZ ꍻ|5s߮L I mF)IIL91<(V wi qF SФ1Ѭ*NN' IL:$5h!i&STgT2%)aIqPx32a{exBD !ڔB4rR蒗 $&5쓝4R:A F ?!;a5HחL5tPk}q*%&&SIoTT S0; %5m7\tD< $&d.%+v|Gܤ FCIѷkF3(fN'TԲg09h40Ωxc NA5 *U{G*u۶5A-מȕ2H(ĝQ7*gu^ZdBn|Qy#@tC[{x%6{>!#VBǶIǚ)qs@a;A.u0O<"TW-iJ`@:nYG*>U`] '';#KMUuVW[A" ~ʃ|JWO)zL9me}\`n6I$IjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.T< b|+[t*\ZLV\ Q>!<T=C%lucI8~}0N ǺCh⊑9Š0e>HsBw4a3G;w1DpM}&$J@dҤ55?ud=C\w@{+ 2v!e5f%)G J偺Dd<j5IPJ8Zcݧs 59`2~iIl4Cw}vƼ;˅dTQ ^52'{vI 1-h`s ʇ)cs=b0yqSs&9-%mB\eFYV}4MSQ䙯SmL׎JKmCZ\]n״E@>.ž[ A e/1XlI; ,):DJnQNz78 ]X.0Y>ԄR HnS$JD{ ;H{X1wֽE5& 8Ʃ)~:k,c5\6hx( 28R$$݌A7<;c.J9-L q&qs=GGB.F5pKZ֊!9;[D% k!iÔ|v!6ǸBZeS*.TD@HSl-翂+uX`slwdds $8vI#G-Tk:JKU%u*0yNOޔ0c [FuR-&tJtJZ=䤥{J|G8Pݽߠ;)7uU)e8T$:$-g\֠[}&7BoVRFh!hGh-ޜxL5Hp?&`>҉i0 ^K`II1 Mͬ"Z!-NnD%ɀ"fTgG?p36Y DH)%'L$ 𒘵=6^y(O/cupHN4'R{,>*.qj^A^:MSR$ZI#UEPd@Dwt{$.cF4wFd@0h4ShU @% Ӱ˻hw;m)JfS5ےSݣDW[1'_Xa)TB`nRNX?v 6xO*{ߔk d4)-:>wA͈Ӻ,l Pi5Q\x Q%'B[c^$%"ߵs{$8o+X:$RE w04OtI#E7O.: aM/nQfH)IM3Xy4fNۡrneuQq d4QB@-> OGN%G Q-'_6{S0[_T6zpWi‹I'!i{Zn\ D&Rc[O6CbI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.Vg?t v]ԹH@;2r5FAtViԪKIh#F7^8SwҦ{j{9e'DOA9R5IQh!&4o:(SЍQ.ߔc\aSZ``\]u(JD-g5ٸs=K*L\$ptNĢ47Q(`{APGj]. U_A O,;I si`j`h$R=CvT:FQ;1IL<L' {=Xos!Au=NZN4CyuZ !)nɐ-cw:%WWhQ>O'IH*I"II$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I. T.zD?Z+#uwZ;7( TeƂ`sVymq?HH:\5WsFv-QXLH \qc ikݰ{cUZ{TA‹n)a暦$@X׺% G`OeU . eC!z`iMĤmo@:;V$U]֍FEZ FdBv7bHR k]2+cC'V ƽ5; oYi4@ kN$;$nxI,sd} {`xN{p[Fݗ4ʋAT۵Ş!A\ࡺ!YcZqQfSHdSsw=jE p%m5H1E䡹t4O0ƪn€i>S@l WCjt{JLc8A3kFRh$kpInۢJGk[g7i> dj;)CQ1է D ѯ dT=y} eWU"Vu ÚuCt;C[C[IHe?KEsNЭ3un&@R{d@|%E)j--= Z"$F<<{z) TZ});%/QcdK[ T)[O*!6*BXgAĉIK!Ǐ#k$c-p5WI!8yh9;lTԶC4]ScvQH[̦Ѣv4aH>B fR7 a Hm!BnT ~7M6N:AoԞ_qN<ʋN9))j\V\{O& .bgX) (ₐđįsg)L%Γ)KFӠN󺸍Gt?mUlowtM6:'JBE ez  P:tO:O)8N%#倁%H۱5J~V5pa0T ) mkZ?CIBkx'UB_I!D%3A DS=f}6zdDi^Ij5IK{BbFp[3`'SU%SXm<7hдkJTͯhN4IQ<o<&F%3IqCm*L`5r[J@4mKR|RtcBt=ldP'J;osݻ}L pײQ>J@ )Ldkʆ\i!Bw┎JZɔΔIZd@;uEcC@M;,8KGjARC 0s0Mԍ|gJ*J獠uX>ON"vG*7hSrN Jn5E jlPM&TvG8 D 4II}@ Z|aQ {D%DxA.3 >@(Ce 5yVSKA'-tQݵD8Qsr˴R,6@+O=yf؈N^\ @QN EL;k-#Dž~1#:5d-kZ5@x;uT2۶Z6m>+7+$7k ۨX[]*X8ppet}dE]q }SPmh i$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.9^@#D WEK\ow{]VA#NH80vZiYn=p&Z L"D3СQLJaR < =$hB\['QD`Q-8BiR;"pfUV2|Bnp:&oR.`&dik4p^G wpvL@<@cP $"2,t qlkVZGpKX㦪53X^$i›}F. Rk;pZ5< >3B UhhS|P潢$"h%N s@R))|9D4*ڔ:)٨'j(xIM|ksࢶk$sZxLqw$ IHF[ xp {yaR5.NQ?12a%!D17[Vk`y('E2@SM{6L Tٺ6t 4n$S; "7𒙸s7E5?zv;dnIR a)Xg`kʱU.bkn<h )JI+_t[`!cMn#vk $ `tI b\׀u%HMޠ%0N; Ꝏ1;쒘[kY (Q3.Ir`L9%02S%04Ṫ1{n{@)yDÄȳp9Lֹ^ݐ}$@D 0J rV\=~(v`'`!v)~Đ4L^&H5ǂsq L(j\L9EL]_V6(w$lH@289#Lf)O;P5&v)24#pND)nty"2h)D[AL{ >Y<=NrD;RSM<*ϊ;ШV! T5洷! aÄfg(ֿT 12^}8=Tߡ1tTr p!v":ng~h|zZЭ:\ '@iK8K%UK9$𤊓0ܟ%z-l [ձ)-^м5q>( Q-7o)Nx<$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.Ǭ%pw+Vqm.>0>*rVpG)iq,0Ny+$4,ljo#X!aMG& LUy~2 3C!j[-F =+>iRXd*Uxůn(988"wyp.;l[{)) uD:lj$k1q& ʐQ*i4wV0?ѵY#M`΁ !'U85B!SpR-0^wjď U\'I n{4tNd|R,9ĩZ6o#uÏ;`y$SL"vc'hʍ)d)xRoTdSʙYoҏz:~*.4< 7iIO!6 h Lm#l {&$)ɜ`ꖟI2npBϱۿ;jéJ&825N'D#NJGڂ u;UCgiNG)NL; N˵%ݸ#\NXT]{%'DNIJI<+K̦c'SG)!@rJ*L\;.v *7Y!Ż91 ܘ7oA\ u잛 Iu`6@u]@51Ĉ2e$R0$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$ItRC ~h\]AڥH#P(CH#Dg`D4dJ.{BccA\[+\9Hktw:U_SlZ8ikHL$_  CRٸn {YN{i A P\& ޙ2H@H8|jX> w>u)Vߟ;1MO/i) )3ة*@XjaL>Hr[ha&MJp (%;I!SX{a|9¨.ԍB}Ӏ4$<$T{(`TD'υ;C\u)SjT$F,Чdh rdP̖hu+|s=)co0#C wޛ8*F<vR K hT,{tAbqfp CMBS'!%)m-"lwLZq߬<(:חFDG"5L%'[a*z0z L\bUU[=G`qBJizktRem3cۤh8Pgj9RBvPS&=T^0@=kMr;]3uM:R5t(DٰkXOL924Kt%VuqAd2 D "n gH b%.lsZazW)vTNBJlY@TK7A}L *FaFHtvS>i)kkqpP4#E-P!f)&&L&qH)6G *`UT 2Zu*D ΩRհvJ05#=!D?4Jb8S,:4q쑱Ċ vID o$Tƶm!++iiNs$:\i=:SJQs UK:k t֟qV* (#5KlL$&s"(SgD'd,c4OXqiBK=ILOt5D : _i1y$A%" RJrH6CfaF4)k5=(=}|&ShiNy ;h`w:Q 5MID)FO k|Xp o# Rݪ—i<QsAuW16L9Bx+w<{)5FCQ*!HIL.`AbrfuHn`&$x%JH:)%%aP 6\cy*(OwbXIIͥ vAiqɝ; 5bT`̩1yjEI40Vy%3 ph*!pKNѬoygNN`OdRG(y7Njf;*8~FQIp@)gc`[CGe}Yֲt&]I$+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.>IƮ[B}E1K' !k,ޯln.#nAQrMF25 k-LI&U Պ9הVg_X4ҧ7daV{vΒ4Wc6<]t ײH*Rqݤ f(7;G n p%ǩi{]ʐt<&&GtJm Bex$4J>֙hӕ6G粈#7I tAF(Ru:8j%V  yh tD {vR ;e孇h\m nqF Nt!H6=; %=Lx&/ge @I "֘ |Sc{l$ T*h9B{:_p/U*JrE t )Vڌ0DwQQAckF=/t|wNn4 Cl4%#hƐvꁕ!NH,g4XI&eN)V4ʁ"Ds,؅^=%=کZ; f%2*!xt VmTs;`)@RFݼEI3v`$H(oHҾa @im#I )mld_[lh:14'hk]4OIH `M[]{t >I=F@ )p:7B HpQR0:|A}D>&xU`>çsD<)"ÆѶk )=h2_^ Jk""O'?iO 'D=8EL[kDK)7s UqLW(2;v)fCZOd;^`ɔN)rǔ5 I:Kl$`ўfS5`dMtMrJZX?EbS]IyQR @tNTWQǞȏkd =i&J{H h8l${RmcZQ-8G)Sӹ3sd{!UCl;Bz$Hjꥢgq@*Y`hB$pU q3sh#@R`|- 3@QY4<'U>fM*Di)07#04hR{ftQDRLuuǒ.d54s䓵02B\Ýnco Nj>P\x9%0?Ȣt$t" x@qH%&pDS]DQSKcFYo~Jv:AL8ঝڤOE| 2ZuRp}`+8p\Q Ug(ćy7:!|OI`yVLr*{@<ʫuw۳]$Tv8 gitKV!w'Zq*(VƁW˼RL׆;Eb @tpIW~)ͣ@yA:ځp+Bnsadu|yyh[x +o2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-jh 9;XC )HY [*e4.i0'ѺlfOuQAzd2r,Ƈ8IWUZ<|+C\?\5Cf-:wD:%k@2U.\>Ե{6<{ 74AY`E':(HRT)4n%"ĴQLiJvFB@ i ELdʪ aY[x'逈ZIB N"\*kJlcAFߚJ,mv֑O)È)i}[ϴpKv&v)=8*,$JwOܙ)5ڐRSg41@C[%al pXǍp7TƅE8^JиGVO`mxKF)tʖ'n1u)%Q`f2{>ccsZ :mCn#Bf$nҴҏIsh 4p} m3afSNmR qXMsIEmI;)( EAL*o:=9*x#US0!S4ptTuP7ӍsL#|BG^R` zK\'TfeJCQQ"hSuEHm=[kqv  5ձܘBwr#)&VNJM l4_ys8 &2L ͎a&JVF9)"U9>h4RӷPP魀JY/ 5KSq*^zУk5Sq|jRܒZ$ILF)2~nLwnQsyJ|r0Say'4&jLSf9s!) ɀ>:65ՀAL!4"YkX@8TOdŰH'weNR1ǒ Lkۅ0X2%sYzөϥ sVzC2XlOEO~l hkx i$I-RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$@=iԑUDXJJRN0y;,dBi/4lx]cok\)X< uznBsss!8w\UމvW}P[7pc!=[8ywYY -&g@RuD#h7ONST6 m " ;d"DZ4(~> pLY:BJdXRR1.,{ $j΂ C#@OKFi5*s{TN"A}hFBnFZF֑ ptLN8 ()Mg@ 0<{ UO͔D2mTDOvAfY)wr:hQ!ntά[L縀L5IJN~"2ݪm~Tp`;y*ujTN׺:p{( Nbu~* hlA$ױ-*.$#˄n`lj^ I))7)$ƪSH:j0Ȏ0CXI\\Cyh X\zY>TV97A=۽W"@Y}ֱCy]6;qг\ē2I'1&I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$7 qqhtRʧQnEdǻAeD -+ŽzawBP$G[Q%SqcJe%au/̼K{vMCuTE:+]/_S7hP*ֈu؎.c,%cfú^ J{HPy NKzeVB5,kd8L&5AMzq\A'+o)d{|3,}.i0eAn Ӧ9p)k@xzdJmd?Cs[[$& wp( hw1V |Y${k⚪C^CyCf4ޞ BJBǾh)]S-|+.v\ ;$$֑2TjӔ\teugF˚6i "C{R &0F5tPfKy.O2V84O"灶:G " ZIQJ6'oAF X ^S+1ևNVpk\?u\fvot6wRPa Suq@s\\"h U+[eS:SŢe*Scô)ᨘ*ZUZݧHvNtQ$' SfUMbuC.LuwQ EL upKFѧ# /Y\4)mSua kݺY&]n&J`G)8vIb FIpC9ISʃ5O9J@eD:S ;w?{tSm6l9S@WSO)ulr% ?g]Pl;H eKf($촵yjX(x{p&|BnZ򒘆V ]вoluL&1$OfEćhSkko*+NVe ˝S:AOuLy))ٸG#-ooMvNkN3)1DNDU鷻kXp"Jq+)Q{\s4SGiJQ$eG(Bi '1*:VS0<{HyD߮Ԟ%!~g*B5x 0i 3MEA&q%34n;G)WC<%9s>EY$G8LxR4):4.:7;a; pDW{'Z}()3+]x4vTq -dI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$,ӸD)ItjԭTUZV0Q+7 X'je:-\_Y+5d.vOfMe$c~p'h{Xt\hW>̇q(8Sx>s`GuZ_Q-F}B$7V+2[6ġBk_l.#roܐDWO2Ӫ5GBB^|⋆TEs߫ HPiԎmrH*ni(%ǭ5E3HV v16e;iQ/vR% Opl%6QY$9 0Gt"jG0h\;';AAMVqPl(EuIvLbdٔH{8QmDԺ-^l"uЧjTÄy&4TӗrUh is;*JޜLO0aMBLjE WYӰZEpC<#-dYEt)SI iĤRFיfV;AE,-)ꗦ"bѧ()֟57d3yCcDq%!IC{y6 j*kZI>+,mCNen$7@2;;D<C{ EoVj/<{pqtj,"a-Z)LO%$k ܅f4]MnУ7^O=<2Bp4IJ~=Li&'ͭqӹPsX#ک@Aqmdx@AEL{R1*MʮcObG)(>I] G].B{a{0;5d(8 #@o{)n+k6BUU\|LyKDn=eLҾ{7BnS%6IMvC1ʁx`&'nfNI9R '56IMGU^۫+2\北euFL0 0&ow=='QA% "ŢIdZѤ* <Щ;R4 ="j#0 jΑmwrݩFu70`_A :NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Eg-.B!JLS+Rj5VfOBz+Gf Df¸!q(6 ЊfiJʽ'#Tf5L4 RճMcEYn+ 9FEm J4H5Ul:tԫּ hr*I)No*5MGwv5e8rT:SH94-Di:qka P4:qܔVT0AVwN*[~*.#_-+#AEy .q$A E>']9E`cA.n5?(%=۴C$S]m@S{=1(DǂNvm40J ArhsAP1R))=E=‹wȕk)y Kp &tE Ǐ'T\ `(l:aс))j> "RR AI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$D,ũ!JLS+Naj\+-ExD' M+ O(Bz3dfy4X H**ΆFCP< B#Ea>jݸGZ jP'h p;̄'2uTT'%0O5*zTLh=”vPh5MS 3!vFHiJ̺VaXrYwM Zzy@7a-OD!4kDcL=)`$p9OTνϷE=ѠAKz10Sv'N@Q 2A6_4ީ'SJv8h`FZq{Rp -X)t);bx=@B55neU'E&]ŤαkCc@Oag:QMb`ʈx%5یvOf3 "xȩī >NP|J\@Q'SʲX A#3$朸L&t w&SGkDR. x&NCM䝬3\'xhH#* qЏ}tԷx (DqD)b<aD̀~G42(HxOtP{!-B~9'L7rΉT^gBzQs-%ClO()rOR}> R cMhSSDƺ6 M?z@5CI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$)1NVXVWNBz+Q 0vFbi\  Fc$fM)k؁`9 㺮[+L uCiDjZ;;۠ cW2tFʐQ mMJ't'! 4 qCCxAK8Ϊ.b!U ƪ@ ;SŒͅQ{U^#aj{O i`dٕ&w*n@" L8Ngn>؏:ȯg^T[2 cnڤ I\)N>[u" 9> |Mda%1 ?yAc oq;@OpHiE)蒑!&G:xne8p:)  n $k cyL=KLxIR8RpPR'oܚDj hwk0#d (ZΨ0) CLmh*v3{Ӄ O;$',W15~od[ n2QpEo$#)dɔzw$A>*NpdNAYؔ ?Ԏa sk{CpPgh ;DD'R4$r$G>j (:<66jI;d.[ت^BZ*'@!J'^A,ݮ:iΣT e$0`EV]ySs=a T2Skw7S0*OhӄilD( &M)jIէPx-O*ȄXIRɉN# 6Si6!-:dGܐ dX]"S8N^@4)˜OÒ5RkL %L΂Hts*{Z p4Rv$Ԕt>2:4$|CjGd㤢: 5񢛜XԴ(҆ổ! 2 XC5߽tNBЧQNt ;0w6&<e9)J'Sց8ږD)BJdZ]1Dc˴Pw`Ȃ9Ct)ƈn !94 &|jN<-GY]GF: +"> !t}+]Jst[9b{pI$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$p;RRI$+5`[avyy@)$қxYMivI9OK0$^u6 =t!İٜ/IHwX}\oA#a*KWB^Q + rB9x0|)!|V/B;K7۸FjWg'܇'d7ߝ `p#Q(,̀& cOg%XHP#_${^C& uz#߰Bݟ{44,ؖĨƹt&;L\Jt[-Lll\ŝ.B8W+sK? 5Fᐧ< hxD9]sөX>$dNاr]+^3 dC) Oq IlT-~#%`IC Á઩'s LALI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$~,G&)9h° V% '#1(-Ff&\{" 4EhEiPӢiJ~(/ (uEQ| ijaX@q0Pj=wo|Q |Pã_Tp)NA,6dϐ*[`p8TF-<=Z5$ѸiXuxUGdҰlD*[Ok,s=(|F f)8l$@4I!4G)2kc9F$55d>:#qJl5ۜAI@f3nDxƣ& q3p f~~j-5=i-x&IHxʅkK!H)NȞ\(pNwh<SXLBr#R&9N O+  HѦB?" 0$(mS](Ngǝi&$-Ķ\SnTDjƃ'sYt8r5CYQ΅5Ҍ@U]Q_9*ոlEN,Ƽ$ǚb$OF %+\X(DzAߑ5)S;D:J!L _4*VϒTjyyD) {STaǀXc(a`vVk\7V>@A%M$v1 ({wH4ߝv1)E5MK] ˼XtR{HvKu) Z(mOd\;BdJcN 'XKlj☍S:EAHt0p2:ئJAw<;)wn.j*.rҖ߽$!!ÔF=h)41p)v w"5 A "<\\SFF= #C &S""Ta<)ݰF8hP`%IĶI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IBFĤ$iUX~AA1:[k\z`}#1r4tVmVŭDp(Yb2%rL\S#*[['. S42mR)2 JJBKѸuO <(2W@ I&<$% &r'Eݺrq2SoSA*$rJ6W.lꡩ@HvAo !Ϯ8U;{O ~_T7Ta ;5$.Щ(eSyS-!E?D$ h$ @g8+>v\=P~!o TL \&; ۻzej=S WeYU0iRF ݲN<&˖IkЏ5T:uLi/2JH8;PH.]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%=B\֬1"r\f#3"4gEz3#rѪjJo|!#Bx) |Đy6-%;`):(()OLh%A!R.44jBSn VAyׁUcH'w6Xh~ wr%IM5K;T'84e'8mSv> )vwZ8vt#Z{BQ)Hv.g qh$|P[N9jJ4Cڦtͯ,~̣6t;u0E1BN~L4± xȖTleIΑ%k,d77H5%&"@0Ή(/^.vFs|Oٯ~T& N47?+B=i>*53Hו'@K4J!ϣ̮vƪ^ :BN&{"-͆҆ RkXZ~7kKO(40N\GeNl/>(}QLȼa5pk"M3n۩:7Nk=BK1 ODIw> >\ C_% JpRZEu]+yRih0 p<R77iF' ;NJb%E8^^ >΁ALwh4U(D&L:(Κ&Sd ;PLisGDD Xk#Jnca:8IrO{VZʫuwX.H?NJM<!%9A5`%= (gƁ<ԕ"aj<% @h:otɁ<& GFR-8A x4hJP j8N[ 3$a"Oi u64蝣MO)!i:(sai✂DB`HI(ˁw:4H4NPB``'u )EI#9v\O(/(N J4H@۷_Tt :v2xR`v"Duc䥠?5uHM׍$ꝲ'<;"cUQLRRn$DVˆIާ^<O>(OLCʈYo+uO~{;׳>C~1t}33{{>ZR;)2u’xRLI $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JLJn2ݫ1 $P.v/Jk!ԭA[XRph@mȖEJA!t&'#=(-`tRM1nDAN^K%ZTHxPFnpҬn;xIOIrt)fIWhW:v&@J[4S;()`{Ba0L0$č}w%5-D%as$j#NRH_%ah :wLt_P.ׂSUϤÚG,ƈ6\Ē&5y, dznfЍU3..l( ~ D6 ='qI*LT 2RM0{wpp iwD93h,Y:&B@1s|\fTAxs4I:1!8]`iN p"%Ht:(*E6g4S9)EK KPa%8'Rp%*S@=IR)h{(ܐM&HnHD)9s`L _Hra@jGqNL)Scʮ[ 5%\J &-$hNᤕ?]#){(m",Z`߯}~IdNl3^(zd vGB#|FgK !ȃx [xDkøUo!!qp2EwiX2$ w L`Bx¨DBH/]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[X> mbD)J.RQr_ |+GfW 2ЊtM+'hB+ПEnL&wy#Pw>( ҂Z:Dg@x dE4Ԣ. KKcc2=pgT L!Kݠq*!;"yQj8N4FNBIRC Gʻ.sKUNwm16!xDw+Fmku%_Xc'Cz!i䧃ӆHbP@"4V@r$ CPZ p2$vXw7;JIU( ǂ`"Kq){*}39 L;[B>i<55Td(MI\ڣj2Q0и@vI)jfd1-:,OsX>jVhnĪNS6FjmAc34;y:u$x!sς A*;AYŤx5sB,?EL4)xQI: =Ӕn|վ5TϰHǕ&4Iyթ:8%Ȭw͗7]0tC$$怠[IB.]Yhv6O.+Z jSgL+SyC`qp:N'% ᦪ% DF$SeZeE#4AgtSCΥT%!eDWΒOuNZBxdj(TBD=ӂ6uK`S月>JN`yrtRhꇸre9 I*/sTrJaAKAğ#:Ӳj5)*@A8pgCa$ς^: RCjښh 0W%"uDq,!_N%$;!2Ouv:8[p @ky|R8t#bwj "TVcnfDkAŮ &K\$,dk߰Qx'“ ߬L`Lμy >CunO~5OS]L ))DL8. jߢ}?<'%#$<Kv~D`ٵ#[IHࣨ )wa $FeSvZu;&-A"f )TBx#G*4S<4[dGUO0tc\$# wBN>:-q4)B)dfәRi'k7hyEs&&]RqQ"RRH$纛 $:!I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$J=$LJU.Dl0ѣ [h> v`Rv]DAowR6Zta2ˏ=HSj}>H3[D["Oi7R2d ?BqQxnGޑ"S*T3*JlR"AP Q):E.i*=Zp<Eni8* [ dAO=Et]'O׀am^}X4pPSqO4.14 "5y:#UuV+",lx_z''h!9IpAONǹgXLڏ* #NNwcDy)@tJi)%+זLHou^ĝuLd* t Y8CIMt+- +,2T!!-'xP u˂flB!ڨ$V{#I< סAuPS%&w)$ m@h"v`>*5q3vD( i(U[9^uϲ*zΛ .iדwh%]cv%$~^G:%΃ '?Mo.S[Y&9DlmuCd8Pc~* 7:(8 %al9Oa^gS6&kg@Uq#PPH(0{fus$jV^#Xkt g2.n> gN+Gì()= 0`+SpFtP>ʻ[NsEZ{"2aOi)5:"Gn#Vat(EFkƩȭ{SDz d0*Y. C>HW1dVҧ)'pJJqȨC%\ dKG1nO+ @HBt};cN;l;'xX9`D'#TP̞ suQF@ 8|T[ @Ή%@JtNTI:cGXc =*Hs M ͅQ\PliS:4Rk [ DP2e'ĩT sָ ?f &Je[< IAO&u ȍNJHHOM~>(AIQ14JnEz)SC]xW*I:*t0I*&VGQUbdKN.j>K`.0 Ns{.W-HVcbo J-RI$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$@“+/09[8]06 RRI(Bzo <CBT.wM2kJ\Era ΔwJ~(k%&ygՄs6#:JDPH#Fn{ zG~S!3(.I,<8HIpO$XߚfJ3_ FҒN˧@[9h񮜩BI 8:jR-3)ru*K"%"8D%ANn [`AIK(JS\ 'wɧ  )t)Ӕ3v3ݴjJ;! 8> w{T8^颁AKaJ$$]֒Nz|#)TBi'ܐDq!BƒtJ;k)!$4蓂e.ʄD{' hG)oia:v3@nJf JYdzyRh)5 ^@DײJyA.'SJ5:&Gu8RQ}@k䣠%-)R,hTZ] v RJJr (5)= BUBHZ c G x(Zل0 QU1䔇S & 9qjl5T $O !$"U9'8`I!HMᤤ!-wW:&ѺFHs)A(%+YJ~&ܘRuMhP˵wI:8גx8Ph*QߐR:h5I6UxQs]NuHDGFHi'* 7r #HׄKD[ಟ[aH dט6A xnW Sş$1t%(6%;$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Incn%+ U°% 'y1&OAj'(&fP^׳Ubʵ2 Q[0|Uw;TS ǂ FN>*.# 4)۩:aAJj$!" gx&hBc_&4D}/ -t'i(9k#Z|5?E;ɋ8<>{,5үdtp@-ohVj4n@,]Xw&`_ш"h~#kÐ*s%VAn=+sK T4*N (SruN$;R[PisDa#\~I*˸Aw%4z `iku`:O0yS4 E/JZaj'BFLqJ$T-Ī6(d聟klfU˓ C0WCуΥt8,2gRA [DJDs]Cyݷ蕹pɝN> 6|LFg Æ#I'Jq}ʋdQ \%H{ihsX߬ )xIM>c"5M|izĞ%CvG0B񴐭9 rANsINwU݇+W:mîlʉ;Jfsf 9(Ɲx )PŒhh Kc`4Y9W`t)&8"6*.<VR!QWYڝRR:"j<u&L?1 !F@4H)v9N̊2ۅS+s[OfZJr z L+f~1dt}w9Z|S@5 6%y`A*F#-YAx`*`"HpW,讯q >{56yqUww6C QcqPSdTt kyVhM 2uUL,ٽ\z5D_7$WGGOr=:emĮˢ9W5JZVJqa.N'I$A I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$@JJRI$ct'ghY0@ca$M1O%hL]-!\ iLhIL&dR:+ 5*,hk 59$)od]N-2BRGdۄ(ĉR$ri{^~ .xNݭP6D)%AL )84R g{tjO .)@a!&L$Q{2a#sI+@htӲR%JCB:C$INH3L[N2~ .RJ)LJYn"3sǀC GV/1“fLT&uKx<ԛ-ni DaIT>%9%MIIuEA;8K$ OI۩*OS@JJR@a) lG:n.Ӳp8- NKivwϸz hI Jrc^ɸ60JghA:)<2ݒR#NxLѷAd ,>Ԇ}NIK%"6$)٠(K0-3l2RiqJvfRhL8P<D)E6B`))JfDsZMѴƺ-D $;o :QKC]3)vI6pT$ByLN I%q%ȉLH > e`4IL| (6@%q:'kZ'U"ƨ6;'Nf\ Z pE@N kD!PTkHL ZI 3D1. 44Cԝm$#h =ӻ] Qo}R4N^|J-xwmuH3hM)HP4R4Q qN5Rw*;DjgBRx IDLpiHk,#6#i{A۸PsG Ɩ#CctbN#Мi5@}j9N/$Dm!Lj=V ʇXJHNAɍTvTuSdpSNލZAmxv[ HNKs4Hx)HhPƒ'{W)HRhv'fh8p"P ǒ-4Na?Ճ泰=4;_@oN|HRQ"p#Th I;DTJ %Y[d:M ]{pzcA:(dj@PꕮR<;$/Knl_ U- > pCΈT>J4rz ۹QǸഺ-WoOlPwiPǴ9%XOU=6#OF-LLH|ʶfxZVI)=#DV+$`z1hy%fy㪪\ җ6u.\*$\mS<]Nd~sD@㿒L\#X*f{'ɭ=jc4HFsLaXa*Hl)JMW(ΞwD7ọRuM|e5I9}L s S^GRT۴B1i簵ۈN1wM`JƘ׺`KT=m;Ao}J* +Ni#^Q_ $jcpmde3s8HDϲ_O"tNEwU(EwDxpU%urR%ZuH#JwIf$'i]gwKCS&$XӝB.W>SYAWJG[&C\[ w%ftw=-> US+8+Ӓ9jʧ[S:"P!u§4[O՞]NMWu,C"4Ot..q: .{!tW0t F=JZDK tBt:I$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I+S`K4@u8 R&J LL$L(% =Q ɘS\b|S4w)tI LlnD QٵԔ2%(fKS: !3 hW4RRO%)`t A7x i&L$-6) ks1)P[Hʝᱢ~ %*.qfQ0qp$ʑ&tL9x!2]HShHNWL yCljT\`To %.TZ'LpjS4Dộ%%.1A4LkZѠ$.HnoS I㪋ۤ8NHה4 %pgjS$X'>0M> Ѧ.S- HPK!D(p4I{D=B )~ 5)Le8NJgk`)2UJNς;uNF'7?DO)5Sk&;)h4X5![ԧAjW+Gb|#%'#33Xҹ {" Fb [䚖Z¬Xs~(M5-[A?X*rGr8N9P*Z&8?u"#l@C8Mq- 8~oe!:S(%mN'wwF wqSmr XmD5lG 7=֒֘j i.>^hha3߬:_kp >˯ђ x6Z4 +V!HA Khxis5B{v4YpU_0%IkP.)-/E!$;4 S:aB:y;*>hUܭClB/橝 א%W4,}L3X2uZ]UhO%_?5J. 5ݪ}<ݼVm#eS+M&gQAEL=2U.E<+qkbXq*ˢ[ sXvJfl8>+WLv4Ɲ8H<1AJ0RnT-ʅʃ!;Fv0i“&$<[NhTE)5*\6{;}3];, M4J|h(%D l'|S<p~%5'RBLG@"gKA*?Z0`pYA}[@:u ]=ErfO;7SZn&B;Fvꁯ+Ѻ5^ .{?謵Yňa:d$H!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$ac h,,X)],TN[|V]!/o*L{L%MQR䎺vLD*upwQi9Am839T( )PZ7HXx_$t nfQs)4zI$rr@ 8ro47HѥI"$~)8ɁʐʋH2n0PdO$9p 8N$FFITJ~4Mx;1wDz.&{cH $ nIx%)T]O ){wp Btiʗh`SIJ"uKvL wQbIR.Z!DɉRKȟ '09IJԟ$3h{&R}IpkI&8JQ0na";ʓq1tȅ}J\pĄDky$Z w Q-:&juM[KFME%853e(%;ɍ9DЕ:j-%(>Dˆ})΁Nn4A(VA╏NU1`*oZCDɜ8N'VOpj_<'"O))2VvJ])yqI4"K!0BN{Xv:FDҚ ԥ1HpxjiQ|wH-RU1jSBu'tI4M-)Ju)jUҚ{ӵ-&AIT 2q AR L{*i gDKԤ淈H4(z "KӁqH<@hp= gIFIt"z; qOdj!; %%0ߴkʏBO!'+ sNӧ x($V{/59d(7 GdT'N`u%5ytq /dM'bĐb2斸 x6 OM &'EbH+I_=5خZ{J,xpRI$I*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*V?L|VZ')AjVGg hIr' OFj34B`Fbi\6F`P,ZdvXI=w=Л(5-{ XcHuRi?$$QoBƃt$)}D}iq&SxW+mm  ݹVQ%9;^7{]+f HX!2X7 NΩ RKH⪿ ~k9X{2l9厞81D' qDB 2O()`?)E"ƍwN8tRm{JS | @gBk}&AT0 5r7FXU^{Y[q.3p>J[Hi}hKѶEpT+ VASdSeY*%V P6jhкL[}[tp6 *h{j뒓RPh; + Fأ?GRHQP`E#ICՎ8YuJ>U[w8*0C,'Tw4B0 KKc6as@2{.h.m5JG!89Ipp/c wvMm&uiD XoL韊蠚v2lVGxmq0eKUe*$UJKk37PXCk3HU6V* `C-%e4]]FvD^ Jk7jD'v|VO%nͰ R{(@#T%2ua|gXy!8XZ(: B/(eHjR7X't-cU+q4n)Ŀ#@%I?Q 0tH 2Ă$G))Ґh-O=AܧPШ?CJrvW0ƊRx.+N&d HhXNxAI]["ZA8P uH*ֻXN8ii#SE̤(&T5&@R^S < 7op?rZ̈pl:uSt$h @O1۝I(D;#RIINۻ B:gةL"9Ea*!R"SLd+ƫ?ӲeU(V,{W:%ӏD%NE$Ct>+T7O5&6\ceE&Ű6I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$o"tXدFXDI7Rd,|FB1ʛKe0I%rv7z#I}HB eA#&D4 4kI /3HOd6? : QwI$SF N!H9A)-YAt'd~]_K"%-p!##A'?KQm GdAѢHnKrDjU#wtt-.| AN*պ %K@$2UAipVCIFT "aAu "?F$wMp& jwVh7$eL)0R1PXv4qLS5>`ٛuHwH4 `IT Oxh}aXBIjSh5*% X`!;@hTB4@2 O;}"vpAFHj@LRJ[MwjՐͰtFxbgb9(tKg )G- ࡚k+24rJ-qk{J{uY9; vZUCS?y67A\hnB ?{~Lm@J8"aM"lSu܆!bq ӈ ,)UJ#InZQԭ È7vn 񭧲i[c"x ` -V+괻$8Jӌ/~qسCv3ǁZ6 sy8Qk!D,7jd.DjC/-;|+qł}'}rDf NBp4mWfGx:+)->]S=16IA i$I%I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ߊީac8ߊީ8)JSPrv ۢEz!8 ڣ5v&Ȝ~aʻ+)4J Nv<#S^ J`)zh4SH& H%a~GJms y-xG&HlQT"6yFC-%1=" =1'EZ qixU\i]6>f[pyF[HS¬'U3`)ihb`zd9Z6T@lw=DwQrP00˰+2,;緊! &9YkF< 4BwJ yTxVp]FJ|;5aQ "$((MԯAA#:{U'pv(ƽU XW~͏T 8ꓭwe*tQ̲V~;(Mm&J]:#接}cP2q.z}ɮm,+1xnTTUw \cĨHHRDh2> X ;;HOk*P$|A%" R&`dﱻH=M w( S?kwF5̫"uvP4!qP >䂩ĴYa_}CkDL{w|b<:g0hQd̚Á!k>p[~"M߅:q}Lwn y2y m~204|Kq]t rb\ rL"%.:[9sS=6*$Y'Z股$LQC jviا)DLPq*DF:yĀ~*m }o(\&!9 <' 4p;" yHRpk PILƎ2@ QxILLvֵYQ`(;PN/T+J {F ;@>JuWdp \UO d#t?Es8++yDX[$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$HRnphaz5-\!I$"ⶖ·➶nh pLeg0!RvSKKh: %iytL=NUIAvvIJ"J\S]=$IxΖ%L4T%%,xJ D VDd8y.:I Jg'vDT!'Kp $k>9 jL-+&)$sb7)y)w '?R%,iD5qTv741))M"ȘL${$hRh?.L׺f {QŞ%1S&~ RBba"{'NLЧFHI*jd ,%)DaÅ4W:&"G 'k`(']a8l:MS!IpQ Nǟ$,\)^1:\uR'fR#n$-L ݯdy3<;AILXw5( Dxz$5d撖p5Kl&%Hmnh7œ*jJI.kx T/wwEaA֗nE484&6<ΡGU.RW'L"@J %d<'}Th@.$ip'HNĤ(¶|J,*d 3j? UrRxt!A6$JCtI# GiI9HBzuTPp'Ilk)Ykk-DncZB@Jh% ὿@DJ8\$*b1owD2gTKiJY.QE-:8N0wBq>JIJRZ2,)$rö|cksR}E6!׍ o)5(w P0U֓G8@âuAeBJNI2#G SRlՇTSZ` ;Z|Qy`l(vTTPjhOPDnU"IAKz`NkaP^SEK{&N{׳8PI VסX,iPVDB:f x(-!]':yեY-QsIQ5YI+b5ڍ 8 ^I%'VPRI$I$I$I%)$I$IJI$I(R JRI$ ƴҦ HI$PG7)g%X]$Ҕ+jJI4f ?rJI$RNXG!2IRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Hmon԰ r!MAj3+' OFaŒšR/{=B&H&N%0*MAL:|T{hDwS €tÇt R#T )5ĝ?<(qi $h( !1i N_ Cukx>Dx"F'=!%xcB<OQjq{N9I!L% L RTw&O:hDjt $i(n=cABnvoGӫ~HJmSr0h@֑2e1K:(|%KDOu=HאSÙR"9L5))#B8RtuNkg DgY*mWJ 5ߎU]7qTus`@]U4z658WK̵pMϰEn 9js I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$a:#RA4I^Pw|TkkQ4jVX%2SrFDsHvhܦ,i5Oc>j'k'N%,!K]H wPlpY8hĒT炑Lt w88ro08Rs=6 $;'`wNjhT66TuRqFB䦉L.<^'Aƒ`RJ4'ss!<̉Ih%& %IA;xw9R`,nk )a3 5ު-{:(8ʁ}S=_ES!:&.#wirHo*@g N3[&$,ѬvR:5H$?tv7HA &\J$@&,I<.&64wY,'Z%'ڛ HX~!ⴋMhs֔8z8cA؋L֠(mSUEAe{-XC,@@lO(L,G8@~3WB1Hၫl,IN)B$4Vua@ N^P ;s8^a?*@8l; @ZÐ$ǚS%P_i>j1 N*D9B[2ISO(~Ѫ[Bs! JJJ@;hCA0;5i$k$O:(yR* ;1HMe;#VQt&x*.|DL 6cVKIPS5rk*M*c(6t\ujЬ6f|Ѳ*f_,Ct$@Y?ޘj|޵^%kt}Mt6o+p.]Ii#kB<' O+,-u[#UkuF :H2TH\KNѐG{5%A"J!DmŲXBI]$$$I$I$$I$I)I$I$JRI$I$I#<_ nSPrPr؂v^9 ȅ BhFbiJ'FyAq@;FsZ$*գR?F4v D $BO깖O $"4AL~Dh;&cD<%“D&uO2Ёx(o2f4YN<yRdTILf{jkHaE; *dQ&Pa7_sѤAsC{_0!VZIܥ%B~4U]! m&%Xm[r_G bGd$t: 6ܓll)A3='#!%aDn :Zaά8;$۲%uΥ3Dn* U,h;Dl{ jYEcwi% Ӽ맊-<˜ T8ȲAj=@ t_ 29={w䂑;q]PmHDGziK1gu>jDs*J @ G cD5@< TqݡJ 'TD׺At'#hE6B P;|aFFf4CH~J"a&mP{EN?dk)ARؘB}?p(dxMn"m f@N[=Ю\iRsvTNBY|Ҁ{IAǻΞ䝩p{v.>ZBFOUMĘܠ%9!MҬcge^i[V,(>I"[(GT: ; YL5y:(]K6 O204؟)<&JM[=ݡFf%@zL%'l ƚ{[F3{_-{Y_XRߊpAĭ.㦲I-__IqEk5UN,/@I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I))I$5t}?V=/ ;කz5ϠR RA `I(J pp\Tgw I ZIG]qFNA{p~ưYD@N8M;":4$hICNTwQ4RhƂw<ʋ 'IO{BJb@Ph3%@Lp nI\'& [#۰mXTk j ;;,R6Hq%( uN ƃמi Nj~j`HIK:RN6r& !πIKwD.wjTJN4E-PhGrH;tR%1 ;Kl;4Tb5$Z5)uQ#r~tLjxS_/ Fᮉ"RnLy djcw>h1I4O*.p"+rARkQ\2SjBp1 J $3KF G)d g&^HoX $5L5EjS•NC '۩Ip &\DD7 ć.k]X :/0Z|viN j+]D^s-ln5DfU/{$I*YU\IS@DI"e1)A&0i<R r;/s7ʪvuW[u JW8z;RLN6@ WEܫxX ?*1z8J\e$[q; %̵–F3rKϚ yMtJI2dT2tJPt$.RNM QN3)%I&+{y &h%iS@%^WE5\@YwuS~egY>%dU^W+7*1 2]{u*Rp`, @I@m!ORM6e/SUʖ-)m%)_oT om8GUɒ;AXKՇmrֻVFVR#0=䟂mkHG 6yIZ*uB@Qc&`*u7^O]sGqh0!:#mr֩ l%fB4'Oc}ӨtF.jTII Kdm'8vH6Lpm$ɝNL QuPcuS`L^ZI 㔚&T :hN%,%ܤx"ѣ4 uG$:\TQq r% BqSYfEJ %") HAT\k욷. \DTK 1;;9*-id)^ B U :k))rA0A25񮉙o*'tƨwAEAw߄ =$HLƇ`,iRMKTFni 5hY\77y%ԃQʉ` 8P.q( AXT+j--U)ВX7T | ;j0ًS(~H8 LHz[]D!YR׷(x-n 0oE'BS?<}Jׂ;)4Rq[Aਦ!snP_[avP~+\&S Io{B4a"JA!$KA %M)՞?LK|~)K)ܬ1X`+GbEr7 NFb35ipB@z3ALEhM\׳]{Rf*g:V+|Q% 5-k WG?zdp9U:J!K#ݷNA);I"ABq!:iOΨ)cqF& )iS&*1*U28!  苿ldx"!ZaU0Uz+4 Js-h<]4/|N䱺c@de43{&O'6\4Lp;*0 iO:ꙺ|e9gKJ`~O}ʙϥ 2՟[ BSaIKh)!LųCnӔjFL@ PgT[VȻ>׼JRaPC$XaڣGE! LDsCyWf*5tiM`*Eڢ4I*½6J^a5(XӅ,yE_%m+YsĐ[?!ɰ_өwusBtP0> ur"TMc4ke6K@N):PI<)h)ٱ-S9N(‘B$+~XH"G[;)Dl't$xy*mHm,GA(*L"d6BqRsli)R|\#;Lr b55H㮊l#C›i;lv>)#UۤJ(`̍P&'ܗ' 8 V4Q{O)5uP{qHq@Q1 lSV=E¶\L˽B  SSSֺ}=#B5Fp٠  B+hDRܩc۫ꦟPI7Oh $u H՜#"J}@XF;jbCg9l+4H:(D]Q=4YEL}cw'~Kkg``r}&e><(Kp֒`h抙 {~+Mun?HT8M JF){ցQ $A )/n&sv~Gd2hPw*2a$7)v5 u ԍuP.{!KI;s #ְv[I\Zpg am}\}%^hH.Wy tX[$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$O?^&EұEuܥ˄)1:ʽmh>A eǕM2TANQ3“oj@Ĥ2N' )ij)`$%c[9焕 !352Ki3Tˈ~iOdtK~)hTL7Jw{nHW'Ԥ=Cww)g*u{JWx쟟QA 9G v?{xj_JZHPw`h ѵ?O% 4SKc@X:JI\R1q*#EA#Vd= C5T#78 <73D7jSẗh D:"V9n'OS꘻MQݷ@5Il KJTwR$LRkF\ IO.jg]R}5ϒ ''Bzڦ&t7xIlIKGrΚ$Z{r}E;H`û">EUkJ:e;yF ;?H)K_IrFԜEy*;<^d(e4ER$!x;Jw;,R'J8LT$P7};6OQ+f R]'i m>JDux-LJ.% RqI * 4DR|*\ܭ,6hu%Xh ErF)CDN1OG%,$r(F}>i%I&A˯ *8VZtҙ^p28"!2N8Oce,6Ĭf$T鬬{6 DWZT~K'eR1LNPK2wk<)5nuL&#NEMNrѢ&SOkwIIJIe;hzsGd0;(bS_r3=lHbK 9/Ry+r{6;ACnc8Gɍ|JmːcZϱ۵Q5Lt7 >;q۵7c:vݣ5,se D2>g0ڹD:$D ǚ1RE! oGI)O~#u)ʐ%/S]SuaEJ\%ˆq D I Ra(2)xTC5<) K$-m8SO0 'Cj]"Xpj _^ONpnEIC,& oIOd6D3hB耉Xpv*rٕ~ȑ)v5PLO $7q:)3NL1ƩV4>_</s).8`]Ѫ0GRa"R^ggJgrGgl4JTfe+t Xd8N0+?k@)Lkgz*WX=^kZg)<,h"BE d$P9}k=ͅ-tWmey]N `h-F,rRc7"Z @EM+v'zĎT9Y.!$RRJ.Wrmv♒GZ f\ܚY 2Od;+3&5D(H'ÿ,P#U,!NhU Bh BB$ 'Ul5Bvu` $SmD'uD$s0[ԫxY6u&α5)L+,{%Jn>@!1nӧuUH\3i/.aMР52iC7yeT=KVCU`N)R|=>h9)`.v_%֡4IINnSmɟ5N:½$)ۣP-XQhe Jl \;; *d0Pݩ7\'%Į+ Uh!xGuS04@&Qhh 5A&oUε-p`;􏟤 &*dqԤnyx+=\ZGޯ jd`4R>Cd2t8AdN7Ҭf$m%dwz}jghl%ѱ$WaX2l4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$A%kְO$BԒIΝLP5ӄ`a4e`!t!F$Z@!JCDwLJk$ f@"~H4tI6G)NdHar` NP_.~ BrNI{$]R'O (c0ɬvߺGlCς Q!JM8n0CTh¥@lԤu)HCsc@Kje0II:꒙Wj!"`HH4nS9ɚ=G0-FԐ3g ϴOuk(pD-#L KH'P<"ucKwCOeuIB0U6p?u;Z#NɈڠI@SS8ƍN<~rItq1AJ2a"| Z "e;ߴ@0s(KDgT"VƗ;!g2], Ôĸ>jCMӔ jJwT#M 3 &vX6 k\]E+C!a4mۇM3>9Q9()%pu)<(9Jv9MmdrSF]Jr1rRN)-!$YI$ \7oWII&q*9,EcxUF-oumB}EBk6\`rked MT ~ʃ6FI{-z1KCZ4SqInb7"@Є.+%WkoQùܤ#նN#ȭҔhTI|U8H2<JByKUB`9p滽ǸA0Ѓh(C4RKW=+;R8ZNƬˈ5BxS!5Lh{odbF=]%3%ۺ&J\F%6-% "Ֆ:4+j67húF;o])<lQSDM^kF#de6;bێ} -ź{Z(u v=ϒK2T(d蝭 IkPK*ʠ΢V~Q ?@HCj 1|en^*8]nͨv(%(j)ԏRx[Z%GNs"akţN!HMqkշHyTγճjbR1j'sot6RJ.EuYRq!ЫL*֑m$WpJ+KKH|c+-2y\rm ntMi= % ݯef%#a rQxkvI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ +zL˖OO]h׵ t 9eJ.*HO(lB%> $ƭLjRuLL ZHs'` $[v:L(C H)8;J) MB@@T#Y h=Yl[ah"tb52OcwR@'D`KI"w8E!"`NBe܎Q , -o^'d3BREԏ֒mD:tvs.hZd#T;cy6) aINI+bt02%INl>}Re$6Vq RX1A.!O:E큧%3⟄@7@P3hRTbL)p;vSJLNԠSL?%{'^{(dq.wdP|Rh h4NM;xS;f[®*$ }J{lmM/y=~Mtn;3쨇k=@!(R2BA[ΨR?|)$JH<ƾ(dR&uА 4${:v*IJt|!1 )TA;Hڔ')pjOMuE+~D` TS %1&I+ħHAdh0:蒩lpLAٻPmA$'xLCC H mmBS $’f)64Nh8IDbtM2C&}^=$GnRHQ XQP6PxE +怓D'Rks 7';wI,a<y?$PuNX{'O*P{$Q)-C#n7J i*J `JJ`'T @I %t Sw<`3<&R$[N>L)4S0vE!(Q&F])mkIpcT/MwdB\ vNlh9Q|-HSI AO 5RC\|e$Ams?Luc)9@=Bݯӿd٘b5Rc%C{&]R'KNwVZ]nz&opy ']Sx)tZ,Ѵ򜽄6DAA/SI([xR$ +p/x}:|:dw@p9}* hV,uArmHiaz?h贘1%[m"VE0Pk+;#:7;_$p$$NSJTZi |T'l2~78@SBoŒ D!$qmg̻IZyC5mxQsL b9tp~[@Gu@|`]HHR< Tw Id- {f̩6v87od:wx!][&iRۺf EI@qwRyvEż%I:~)$x()u*N)7G:$'5LlhE o!3 sn&ᣔ͙SE }D g of=J2AT&O!L6|T6|R,>>)4O>%8)cz A%hB!1> ρMr[Mx' Ldy$Lwi$'Q:'Cډ6@ _D$gl$MG)4~4|ݸI}@DdBUk"c:1DN9i wQҷ.c-tH˙Rw<x..x7(jw2$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$W"BAGE$JH]ˠcvac64r#NdZS"d'@kp) =9Od@ot%O4k 4I&L'mblx };(k` =>&sIkhiG*o#lṔ$t0u:]:mѳMqQ.ݑPc_e/4 @yB~D~jTZA~(,  nTXTnOt?4Aw~+hD GE<)!<@ !ŭ,:S0%U)%k1DTNzJ0h.$9PDIVJD&쓜ݳ$QSH䠹LNaLH᪈R."T!1꜐И:piG!kS.6"p R-*"WS矀Gj> -6<@h쫞QQeMp:L R:$A:I'-tI$^XtO> =Ršܤ'K"J@|J_$DFe S#X>m;ߢ\$CS+Ssu 3k*;jgWNvU%j≗bR1I_a]ܫ'I4JIa)$5U-hK`@;^XdQ\%L\s]g~1nS9 ^tKy=˵*.) rMA p|VLXHP) $I2t:$$DpepF$]1H uퟢwUkFUU-Z4Sk;)A،[}OW Yrvd;{̺,t' ǂPA$;Q$w.O$%2y4 #CtyBnR ϚI);xLt 'yJ{ĥ#S^|BrKyMb%I1IKLxRiTD JbT'@rsH:nʲ~I1O(#S[vƉ'MNgs\^N1ƀcloકf;eSt[#z$xNJbc@\ݻG)aAb$Sf{$\ND5<('>@ t$ƒ[̩)T7:`RE!mT6L7O$gO5 %)%MuRc̤uo TƩD$9I]΁LׄڏS9vr2WM~~@ksFo%`UWv]H1PsAvHCN'|d0x ϴBz8y/@ ѷ%,5~֙<pgj%3):: D!KQm}ƅMeKU.lnk&{p^Ah-(dw%Wt6ZDwI9yvAshٮ(N$1kCt `FmNOe"w)PO SsN]`x.0iA DS*u $L]N[($j-DKd0{AᧉI Brt11`|S#TXu-CgC{i(*uH4KBa8 @$ 51v&Q:$L'qIgy&QJ$j쒕k2@bBg:<)N4R0]j3&5CRF{D骀|xI!%{8L+|S 4Do!5%+wd-yO@s xSk|USrQ%q5 ӻF%=ȅDaNkd $&_E)ChqRښ '4 ۴LI)I)Nd$ <ФO%m-5I tIu#D"!m2@Le-Qv~ )n%>yIVGp-( a'NQ èSh3 'y.x fDhS83@joq:#6O!8F&Rݹ1AD۱;#Q*fJQMN$XhJA$ LIjr4QSKanbai;nic" 1GMy -u?y] qEeˆ& ~9d Q>E]-!~2{',ƺ|B溷Zgita.u | ="x8S`a̫=7 [ph='E(LO4Apf}-8:`j< &DAHLyj@Q)D`(F<&II7nM40|w'MDz@Fx4DiBdLO(gQ:E3 Q.(%qn0E3#H']R&9NLhkd#O;N jG#Th#807On: ;M HK}#$\mKp ka¯b-"ۨO-,c!fW+xx&s+zsg,tcos\gEƋ^TeA&6i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$p$Yx k~+[ A4E&qd"0fO(ʙLJQX&pxB 6bt5M[hlۯu'3yx)+v&t4c=:BGB?YL Pw"& .;ܕ@S.4x(`CRJ%NBӔhӺ8gIBՒ[*]3\@>)8zmӕ U8y$&J h gD'].&;t);_oޖtIl <骓TtP p$-di)}0tIuQ2ot+CwM[JN vԨ DtdɍSi F =;D3%$uJR%I$HI]2I&N$I vX\uMZ' O%ͪIJR50S }DviQRƐeVuw!J$.HRc u% VɞH;u0bJ=$2keK )5mh&JH[n4d11 `iԤ5ׄ'2YIe$S5#A*G4R{)Z-a3RLOt8OFIM`;A,'UA'BpEV;43Bwi e 3IpmChD"@Sy# ^#0`N*^P] a*.y8RTPT68s5ɒl: %. N@H%L(4 ISU$q̴!6Nk Ԩ9hXL)JJX< ԅR@PSs3)"4;#G '^T5D(9tl:Q1]#] 5uLi-$-IIu a'& cQ?IO+>q0G)b&hm]vJ$L8g'FwWZ$Ld`v|5Kvĭ-2\ZRL4 {Lƥ" ":PC};!@ S)%rH/'D5"S' &%Gcw2&\Lpʖ#chA ,3Bz}##c '3}("ATpt%"3fS4|##D# ^ `u 4*3'DPGQJNa'xBvI$)nN$(TJGI=sӅ!y,i'% nQ` knDP>7H9<ӈ) sgOy<|;)D8 ( ]SApj_L (Vs~ BS,N~*;t`=[.*EAʫ:q$"NQS7^;&}wdk\&tUC=URZI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$v0I-nl*:JudH#S$qBTgT`NХ"dj§a"4TE">Hytt5̕{} @t) u=h]SW^3?T 9{$IGNlHX&\wVgN>!$t |S5úvXR٦r&{#zgf##%jک$w>;qhD5{!$;[FAs㺙Rt7|蝏 $,=S) p5 0v VS `j2;F'oo4P} 48$YQL$$|K5죎ֹy.?Af sfQ@MsNR ۽IunwF֛IJlRݸjNpcvHO\0HEQS"}ΐ8!|TO|oj *n]('4jU$IDJa4U)I4JS:'H꒗I2t) I4O)0IJI$KS_$dH'IJRI$RKJ]$'<$<qZ$I%0G%)$O>)B RJI$J+6ԦcKӰ~7;Fi}3Rt Nx$FO $2E()F)$R? `&I(  )~!)qԧ nkijid0aR`ɒ oct{2 ~*VY[ u*Z %uۊ#NTpkQCh`c}rs'wZ6%U RZ5P|xC 3NȤ@][|TDD*Q JFIH&x*XHIT5 Q)MQx\I*:' hSy& Ѻ9N0@I2R d&%>N;9$}?$Zs))JrւJA.;R]WCRZM1ԒGSN9U7yԇ_3=$ƊaOS9 OHoRH ,r8jwb^N' +(I '@' 706CH%rc)ܔdJvõM $j&SQtwI0˔COJ\y$<')w4jkJAE>!ˇ #@3HձRRJIw^$8p ϊM ;dR[knE'@$h[ZP׷Т^()-<'9)ZF}Q[0 RE22@ 7<0HL ΣD'oeB]H6CT&@F9B)XIBg&8J|&ZTlpSJ$$hT>I|xHvLJEEӴx>iH\aHTRZwvRh)öT}ChLn0b'TƷI [$3d3 %'<7^ Ίa$8Jf:G @ʎpC #TCLW$T@'jtηe25YnxQ)z𙎠u Jֺatˤ9Kwt\ˆG}2D.U}0#f3 o/faۊ]s8N`p2׶U.Le dÂ5( )oD9Ev'❎ fD(Kp@J$Q^>i.D}=J&%;b[gԇKR&4:iwdYL3#D53Fud'IDA0W%Lo!$qr{hwGOt;#19Е2If>i0 FI^ӬO*MO=ԈZvB4h wN%@q=S& h'+@n5U"dAL y%0RH'9> n/t4sӉ HHEJБJb@3‰-xRwO2eFhT7rJD*T׺1;]NB}ۦT!IBR<PCtUu>Ӳx%cwEIՐ':otiSa jT`"@fL.=Q׏M6FĥcAlʞ'U!Ka[d Y15߇e-Bs_gRrԁd=&πZLXZ!ddI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I#b <䏊ٞLV jxA -#w*P3*%6 57-,D%. wn)o*cSZӨIJRtNa8H#F>[ HI] @{&kEdyKnpGdi*L2eIhӺI pYNT|lm'" J*Cvs)@{4j$ɘMR0N?$ d4NwLԐ?Y&ɚГRȍQ$3I4N'LKl >H'ElH˴ )GpLB`hT\Ԕy >iàj}|$2}!Qs> FPlC3rS|`; 8Տǂ2RWV@@\v>)T: q -#R[Em IEgVKNAաU:ʝ'CS&;"m( QnP(G;2N. L$ ISrE!JRPI4?rJY:I&.yLRR$LDy'RLNL p&$!(4%IK$2S ƚi⒕ $b'2{J#T# )t$>)[3m ҊpnϬ=jƤtLo{-@!$6Z6F;9>$LQt(I(I)4MIr9Qp#I$ )@~T&;)2\ R$ž@LH vHDJd9f'!y&hF0f=6hE$C&'o✻YSx'UU]@cڪ9!7`GfASTLtR -bPs̔(htx&kKhi3OA%+E HeIE ۢfɃI Cv))vu*UAq5[ )O$ $V:c`T9'Ts5)$ajwZ 7Dha$'0))=ڡ aMN:\Me~JLdrH uN3 DWy%K>4LOcdmS:N DʐZ{wIr`jc<)&krCZe$)r?zO "y!kQx H]-.!Ldg {Jg&-Et `'. Pp."iN25#x(u˟'T (9#'@j-A1ʋrk2 >FuvIIR0 #s5%ࢾI2`tq9s[) v*Ic Ux'"S>(l/nT6t:);kI gtQIHIftQ}N䔚êzTmI]nk+9Rd?ȩ7S9IP 'C*C}I0{}oh'>(&6;Ih(@p7_'iƃ2Tu 0ƜF:D#DphS%rM.fxIHBNԜ|$"jDwQ O*NqnIL %S4} j$%)Aa-"yNTF& JX  Z$|R A zPUĆkM聨S)vM:%2 Jbo}R%JQ߷Be8k^5E$ I*-O 4Hdm(@$y $;?vt7U t.Zwi$֐eTDhf1szN pGKk:&?.6ڴt!ag-#1! 4 )vY>8a@%ƼCҜ 0 Z]g\֝"aD>Н)Gax8HK'L 9dQ|SSpRhI R *[gBurgO)BJ[ !EO:pYX0;[t CQ?tONBu3 pf|;!<̑ǒ}{!-@&ҍNI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-ގg  +-f :օrH'Vi(5飸Ex*6F{ Rv&i&1"='۠;=Z;JuM)Ɖ0 =ʎtJ{$Lө)a5lTA3#ّ)[^$W( ,)d“ݴs RL:IReBJ\h@LE1#8a( R{ %iJg0 5NF9 0@=sʃ7$i<uNh3&@M5ϯ(5OS0LüԚ$F=JwN㢋j{)}!>)8)O@$T\IK{*<=,`^Wh N#pw;5 *[hw^!( ܧ-/3:!L7Sx7)S^`1\dĻiOcNTK{A #G=:•guIKJ#Fguۉp dA^lv V$s]ΐ{ӲVٶy:!dZݣ橓 IJRI2nxNBMIKjQ vIJJRpO !ʰ-]IR@`P?:4 Lh[4Qn .}:]EqּˌTr_s.IH'J DɌ'DM:I)/>Cx|S)!ZZ|Ҟ@L< i=ʮ =(CRHZKHQkeKm'E3{L,Ij)Sq;t ;ɎE%> $ 'KwSD=)xݢD0R_4R?d .1H0U܈ԐJBD:I xcStEk)`:7YD5Q#~wޝq䐩%!9 aׄoeMLݮJ; J+hݨ@d|J+Ds gUwMd Osv +5H3AKNP`L;k]T_*Y,s4$kL`i ^to Bt( jZ9D<(V5Zacm`mGa[K}BH!vpS>PCO1O'ݭ ť$k@Ӕ? JMK#E24ytJƞ#<pD=)91Stz!?ݰuJ>PSuARn wm9R 6$[,:GƉDW7M𕕖J}‹D0!Ф\5)kʋ])m. wF:pʀ$5 ~"QY>I iHE6dA*GluIaQy725Qhv<0$A:l`S6{7+)Brt i!!y$dj4Q )F }Cdh /"ۄ`N@x(p tF|N$YC$թvi#p.g`en⒘lLv #PSe&Q\ɀ Mv0?MswSCam&6Q7s]6wVfG*:%,[) :G+)|hF/1!E֑Ȕ bY0#8D~B {}Kf%B& %C aG0P]YSNTIS gAh:Tuh1`u$n>DŇLx"ɝBdO ; }-  /r6e~p]H;}+c{u:OXv1Y?"c^74* D11ai}Dh*$CD_YtqмSݮ𜏹2M0dd 5LhSt-4HjXK#\LIMvI: 4͆j%n<LL$f{;DkY8P.jԜkDyyPqQq'ڈRF3h {`pI` @Go~B#ӺfJN`Є0A d;hT"TT$n'JpĄt~jR࣬"9s[ Nl =CIkSD HNA%,FXiiN9R?6ƧA:YFκ]]>jhV~;*hENiA,c *a<GPptIO@e⫳\dUls;p9h+.Uw?jY zo < ""i pI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$HD?rJSFSGtStnRĝH4IJiEÂR ƣ܊-ڡG)ݵx43`h p $wPi. yI !Yo~nLvR粣y֫{*W1+,ʕu"6GVIGIe@1C@ :1qNwX$p E' T&ok wNH0R@f^5St$ݦ#E T\;."9IA[J%Hj-'KjBJ@y:y* COdGN<$M28~53uI'^-XOȔRbKr#3h>()@J@Atx!"zMat)42kaCӗOdy(6ݧP\wh O0RK#^4m8vlxL tQ">OIiT3w0TT7[Щ56S6R5 D:1)vMHNDž;|R߰@ԠhP2Z 7ML\HS*<)Bڥ-ӲJQe:me6uIrz}!bgړdТ<)LAq0|P o %ĔᲦ!;2F)ghݡRmBfIHtR;+7M :& {\ChHaM-P,0xDq|B%AŰڎɀ *k4:R7IMtH*;Ы  ₗsftᣐ;/i-xE1ⅲB^#KnQ}$ ^T7o P꨼T]IiH|R$'exQ;O5/MշpR۷׽Ϥ4R p{+-R-\dy:B*vy&!xYjuYe$ 쨻Q $%$@ƪ 0C یI*>h%(ٺ3Z'E/$7is\AHUfp+|6NӢQ}7)Ce6$ǙI \w<dHQ KtBud4O Pvx)vi=wd{Yn Q {FQe 4D:Q[[\&Pw n )ײ-*mvR"yS5<;FD\uEekIF8ka[yjO8*Vj.CIjfY"xN\a3LtN %ǍRJG 5۹I7@*L0I,;tBprXUt1|tۺu۴=,es :DcD:=븙=)=xB.J+{i#wti3R}i1n#m!E648>(x\v'!4IF!ENL$KC|/K[%R aVx=Z;(7!NN8)Zdx,JNΩc4=ocHP @Ux |^#ʲ[8PIUqRXuM&a#X:vE4KN+!b6ާcN'>JZ404$ dvL=,s-"4wU ? u:΅E'@hXu(Yk:9 }i9~Kf pGt`-韹'a;"ʰ$0b4&H;>MfK[V)BJoQBQ<Ǐ)N;?kcDn3Y2Hԍ ')oP`$zf@yY`ER*%:?AzG1Hɶ4Sl dNS#ku69$ fq*0T%K&FfJptQVpE:ùҬ)u C-چ%XN RpUJFg R|P­o ʫw)F0 #DžCcUO<3XYur*@O`-GLmR2DI4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KGj&칮H.kfЬxB1KD;iSk`hk3ğ)*$~yCl)y:$t(4Cptײf4 |T4{B`pq*Vh-I ?E9'hLl,&y jtTl:pS DYQ~%$BԐdJv骅` e;=p*M;|Tv~i)b[r'5Ly&. ) H v$*aX>)vR4D (p4% `B*_M k*oCA%$0cr)7Gd;{"AiOv%],tMBֺ2# bR|TpWk RfnlJUSdͣ脐'@v$$(IuHJY$I8ӎTf))I'LSҙ)NJJPI$ '"򒔝2E&N2):R(JS-mwUq70.f-z*aba ĬGʴsFv\vkuG#FP M{aCqI?'y)'IJ&L L'O0N$W@{L]D&IJODyLpH^5蜴kT7HÄ$.JJg;SiN^` U-1Ƿ!qV:9*>V˒˷_n<.i kfOt~L"`>a& \?g 0 \n$(yN}R &:=O)'E & Jr j!1'j$vQIr'nGtu*Uu)wI蒗'4J'Un2YDIiQlNLւBfI$nNnˉNwPHyLw=\RSSsgD@ lty0NR"N3$;H%B6Iwt e䝵5RUOnxۨQtx/.tvODeB*;B%1dB#ݶ!>ݠ95n$L:J$* @N=T%QiBJՙx4NY9-jev-2+̥sI 9Dܓ5O_鉓Ac\Y/@IEO6MT0g\׍XKXְ/ۣxIJ ˎvI [>u)a@ Q*c#IWZvT%7Y=NJ$/sπI}O'x 5'5hm.v,Y%sd EZ~ Pߠi(Sƺ'U+7N50HZX07v ֝5Q)OhhExKoU78p9I ĎnI SlTdGdx.*BW$1B4 9[Hr%4UL@rBN3Fe K\zZ)K[8 B F( &8yP} 7')ʦk&*BJ_M8)9$X ()옄d0ʈ9\ڦ ;"%dT2h=&SHOS RݧFSvH$">i))dCHH@NxME-2$? )@EKr&%9i4,K&:꘥re. $ nR-K@S")k ))@"x*k5њ %a Vf-/t V5j\I$DI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KKld.{OΩjDŽ(RQʔTY̎lu004DGtqlg(.:$ɝZ6TBlnOYh:)$&p$(ĦkgwD}GEøR#NTI!'x1[PT^'@OaH d;)4)DrnMo@o9$R;uԦHNSRkRR4L[HYiUIN;5t'Mh >E9>)ϹvLheMw.TI9H XF3\N)L O=FzE^F@ú7NTDD32a.Ӏ)>(nlu))mFӽ x)I@~eIfYTw*mA \G~Õ'[NJkH#2X agϠ~{ TuDAH&OKb<&%/ $JSH:$I)aE ·▧I$&IL{&x)Gd%:d"9HxMHIf(>cZI\{$ 0 ĝ9 _W{ϷXx׀I'@;*F;XDa$4 *}$:+ckhhk!I):RN֡\gYŃ vײ_L&|e,pRv Gr#μ$j?KE 7_fAk4 dPIP#tk!po[(R0~!)-AP,Ӳ-{SnYEm 8EK> hxRoE2OL( xCRI&T#ETk0%' )c9ǚfnUSou;k:;dR&,}AڨeAjM/$haMyQG=`)^K.:NA4ꕖH#yI@B$^%OFs~`\ F)d(;6Y$LdjNm*@ƉK |7G<0J/O5 QkfBMHH0SIK<sA&vH`DQ1oDUբ fIyU[rΫ6̲^Z" 42&6D@B -":0锞IMV`V] @V)VƝm~MUM6Ƅ#O%^ Cs8t!(>4Au(30M;Hqr%x:ƾ*kd{Dr I#YKH&B}geaHEc&Fy)z04GphrC h0#NQS 0O6փ 8v#GKӕ_y1JCea$*L z0U_|;$);|3iUUr(VJ[t%%9zƀK=.uQEhD7rB(Q]X: S75J5Ϲ<%ۯf0T*{wZ N|*ơZ Ֆ$ s9BpAU3Gt~3!\#j8WWQvI|xcNR#^%&a4s{3XZ>ֱS6,>]Dɫ{lh{NIVt 8S=X!0APNL R`RSEK$LxM9NBӪN#h Roe0|StPϚh &S<($RwPJS)Gc)IJ)|)&uN)DbLDL5OQ"TTπ4S"#DҔO(jtI( > ?) *dN)xJa2I*X N|SJ[D!!O!2)1kI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K_On౺!V~52|gp(C(3#@h65H!DR&xJDXa=nQfbAY!'-nᜒtT*-?|{κ[&Iqk&$7Uڪ]+ }.(!5G[I*Ru%@< w@3o&v;W(R&R0D"+TKI3$@;m;@@Q٩q<(XvPsCF. QaT:B M[)uIb5 Ή8'ɐSD26R#%b(q9QL$MhT$D'lJ2 ѡ`gP7P$Ɓ8  Q=ki:`(كl@T䆍T#󜞐@-zu :ܕTwUu)PwGjX t U}Sr#M@ W nXFОrk >k*\> *"=&_:=D%u6K$s3| GJ T]i2(b'\ h*LA0 SA );IXI+e;L$(u8HDv3G$#/{ ߗ]n,q ԟa,T)C#k :)Ā"dpUŏ@ПD;c:Fxq%R9MDΜ(>41y13ntIȕw8D{ܦq;^lJkSPZve>CS! R G $5ǏtFx',@ESmICkzS{76RU0u@Y9ǀ'윹պ:"&5HkveS‘ B/BέJI- 2 P<'<$p`%0!3[Sd$0N?iqSېLmsj-DJ\}Tjdƅ8H -stN \LΊmq#2{B`@ЩD (0554*oHtt&2sKG|L^cyTi&pRk@8F(ɉM`8|$TMRkH M0$vOcx(QJ0琋L*$`"ZxR1:pR6E!^w)Xa%0y(8u*ݼCfheXb§^FϢ m:eNuXVtJP0!ip>鸸+[yu7٥E/VQ&*-r89I5[-ЫvUw$ ݦ9OUVpM@=+mq*0ƒvs ׉rICmQdJZǑj{] IcݮR-!<I^MF[el +!vjKEF (:0@ WܣhxA3SmͰA: XuI`AIv4Q-;D!; D#_j\ , Noa[+oma܅*A n Q[̆m ^z-=pՄ>xVt̗!1G r`F \( ƩBn̤S)R)> 0F(-'@O1Ħ)a)@$wRL3⊘(LOqŠtP4JRQ()Kt$0&p1›QR _D;S:&:(r)DʉBuRIKVcp$:dT%IΉR*!%,9OfTm;Z;Uo 9k~lvz ]nl s}뇐tUkPdnC B?VAGG>+.?yVs4«5ħ :B\&Y^%&K3$ VG p<ddheAtQv4JȢ{(UԨI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KsdysH[:BMLX"Qt4)7p0B $vL@0$#~BOL8;LBӃ:ѠJ'Qʑo0ipH>%"I$7O4ߙHhd=]@NNvrIrI!C]Ba8)52* J@2t 0 \kM8oslpk8+: 'R$8f DGJΈ{aSO%5ݯ lAg2a1:dD)Iԩݻ',{s8Ij@03timaѨHjS6L\" 3HkcL0$$A%'k™JS]Š@I I);6 JdC !uS:<ZTFFBuJ%BIӲwI=)zLfrfK3NpqPQݑh* c)iFזN- ,&'j!T[^ \(yJ ׻PSkB~ @@M ~fcjZw`[RQ\Cecb7hT x(4tDT{ƻ7 S2h΅3ٰ ;cQL;욠^u쫛6D萰C;j_mr@ mBfG0$hoB\qIK]R!$em>52JfdDIi*yLdNvQmpuoSCPthPdZ55:4N ډ*m:› FV@hI6hB{`>ߺ% m`EH8)^`1=1qwދmF2[fRIݧsK{G%*AמgEEEYuErMN).=Ik* 7S iLOM 9+>TGyX n5t|5 쑽 1^%; k)ou%D1IKRP C~ yiD65PEI4Pq,)#T]N2Фa Bvټq+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KOZet6ZQY 5VdL`` TGtQt3Lm$wr"> 4$59> wbA쓌Rb:B@O*LGF D($,4O05Q:I @<%㪓a$(#8lIhTHl"3ҒY*yiRBw7pfH=D$'uqH@IJa > xO)PC4?Ą'-'A$uUPDJFRx8l2;)IN: &۴)H;'meJsR7Ht= })cO  UIq%xp` hy-JBЧP/ownAK L(\xnPx"+WjZ%!$04VMN+B!SpvCKjur^P[`"VH@q P$BDJ+NI.K )I&N JP%)$N JJY$By&tO))dLR?1R&I-{i%.:dK %)$N\CG}K)` ٺǫ\\Z9w]g<| ]Jp 󏊌'$djB\Rt00H駞I$%,#Lfξ-pIBI)@hi#D$I%,uNLOd9xL EK JF5ܩ:ٻT.D<$;@08O4L .:r;8cǕ#̡PJ{B`NYׅ:*2<_tST\todQ~(9ND|ӸH)#v%d !`E>)*%O1Ѡԉ()y%4ơ;T@!'5IPEumjHرiZ{1rj\<&C'i=ƒ.2Il!Xh!Ma): xIL+O> 5t=A=IM(l(ӡ:8f[dp"V%EII6v'UhDP.*b!; AA \aLT6 )4owݠIwIi.ӧ0u6]-s\9NJ+8ʔAA0ayf3sF&*\"yNL5!]Ķ#=*U6 RlS: ntOi'<f ( ֓.)!f>tL, r{8e jRdt3{vI%r1!^>kTjIy~hVt7[[K ]i׀|)d 9'@tP{\A|]J`{>W T6嚟5ia)(v;~ %;8NxR;aQNTKx(pG [H*B5(?I8ix"xQ$%3Q/;OeZ$nDe@AD'IBE 2 ]C^!ݒ*iɞRB`VڡFtDht;$snc*$|}$Mђ )Ƕ[&V)-:)X2 -ܒa-PsFV@Tp:(ά:%tHUo8 ?P([:BtredUIi%ÃSAgmYpY϶3POv,I \Sѯv-S s].ӲWVc%L*k8!Tu,"`j^?uPi;>uS~851ݓ1tCfc K .P0RdRRn;sdhB2Ќ5ZCa$R3=:B$2 U%Xhit7 %YI E4rq^%Q*t[k+_Yh{voKvP8^7T@܁[ĸX%#OlnU8GptuMfw&_tYnp{}aB 0NGup,iuWb<8W`S-IjK~C!9I!`,2:ԔtI;$Ng5AlpE=#12Yt+cōoJ󏤻wY=},Kn.G֮γHs]QTCH+xS/ٺ w- Ғe:B& ΙN &q 'TNi OCDSK ?* 9 >=I" D$5 RrVU8L8v\*lr}K4>:""uS:~UĒGo.>ky}M$Ʌb|-*oX@~P3,eb@f,#Y^J%a}goo<3BY]g- œ6Y=NC]qNC~+>}"CRZ IJRi)ʉUYvdXST0<DLoU+[6^,N]ᴕׇ |!uc]`nƷ*DB&i$BL'[vtOT V~n☄!#اSF 퀤AD9%MRN:\tⶵ4GfAi&=du-N]rtwn6Fq4xw_V`ϰ|Vaԕ,!Z^KBW ^`I$ՌI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$HخcO.F.QnBr*+AG uIP`(F(3"TLc<~Hp!BI$(hK”G*au4@IHtILf5N jRsO vN L )Dk)F2(IPDvQ"}ER\;^?%'8&&|r JfB1G]SxRxHҝN)<443&aqT\Фǹ#Dv !pD R)X OnbK'ټ{~ N h ;'qLhД@8<$Sta?H $L?OEҧSAvt(VO(+[ 6Ru$r%Jx-=٩vK9ΧW[tnѺF8{G'%B\UAӺCʺ Z XOk6G+o-H0adL .u %%v:Z"11tUw BsE xIPw 04P5:) =T3` G' 4RtL{R/@)$']=[P\ـ9S:Ω%0ԟ t.BTBHVc-ɕ"JN] U s|Ra<{/KlrR;' :;:+.$jL53h;) wckN z$~Ч1hRiv%o7(,):Z]ԫ[%KKDJ&$-PHcd`)>GR@g% eDg?rJ5JuI0>j{4a@UTytQkPH@yGcHTkL'FhT°TiR/#D8I۠Q]eE3'q^N VwTC‡PhLej~iЙ-s;,22AvJy|鞼gvaw;iU-x(Ow! |\]HLSH:j}2(f 'E)!F`K5Mc㮉O<E S*|jFTtD.СMG mIE-g<+msL4HEwCʃIA'ڬ0nXHa]-o0MzBp:kH-#G T,rTTܖ {K:S] XC6"BL%H:lė0ǟi#hQ@ V([T V1:9J1 SI&(!KyIHM` ܨ欚=Ca1bfu7EcRC^1u*N=S3Qu 5.)#TT4 )B;E1^Pn*&PPGmNzHQ“lCdUaBfhu4O8L<5wP.=^)6#Tl\<0 3B,j+!X*Pa7 _\j[DM{gD vTɬgt756p%$[&ʃcPt$y aK-9`ЎJJ[^@q8yK]ʹLk XR\wjCQA 5ʑkmۢ5V(Z&8ߺ?V5[6b<Vma xE`+;*:J%6wt,5[nZ4(y84N/aZ}XƈNըeBNZHWL(W(fBʓ΅ XY)ͼ(u|j{4XY+RXc=9ɥJ鲛70{ymji¸׌TB GbyfʸcdVcv܀q[s #!oU[un[KJ!;aƏkʵE36.wAcC*WsAj669MZ{V#W tt*qkrtgܢ)xʓ۫L&e쥼I+6܈NS7w C_u;Ӱ7 ~ o.9jTk8١ѡO \ VA^yNC٫L~)B;:`,>7 KsG*/B`-xϾOf3t[[DZe,&;ƥ/SisnUP FۛX%VJlI\gQw'Fwĩ@ xpkaq^PǨYQ 0,ʭt#T8*R4ӫO!Cuo tӾu4vU_cl 0CWec`F68mLnWYx!pUho@CIݰ+wak/!C{UԱH  ,m`j~c_/ ck1ODrfU\x 9zoyZ];lc|W?Y!cp'm~V%[$uC7v/SNKGx Ho.GƵkgE^ˇ GO^ Es-)Uq- ѭm7- d $,^6ΏG4Uku6tAѫve Gt-zwa<+ACZ8Th \AN.5 d]GMx۠Q\'_ip~0!>}YwXsZu?ՃCI븘҉n?W0z{&x\cZݻ=Wp%ϲtkбzw׼7+̱.% q|aaЂnkV_^hW 8:I}f^W}~nּOvR/B0jkC$ upNqucЕ\cd'EЬP;9WSh:JO(Qf{ aa1n)wKq(3}iBiǍ Dht-ywh#EcQ++6TV&isQI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IΫz`-#PiHv"(X$-[v 75\AQtH9蓂$r 9IK3!1n{$M J|t)|T%3 x'#Okr f5H)*2JuXRsvD5I XOuH7iN)Ɏ;H6dJPʓLЄ`|R (RC"<tCq!8g3]BfO4334;(S>Gp`( - _@{Tu!;Z@DuD&E۟%R\Jk:8(ƍLʃDB'\tٝV՟|Np eJpfDtp{$$I%0A%)$)%sGNRI $II$I):dJ^i%)$2IHLy1tEitZX^GfNd &1r XZ2`֝^ceqZ 4`J:MfIG$ʏhdJڨInu? $JZO4gq׈Ɵ)$ܝS41%Ο䔤)$JgNy HxI%.Lh)pHLO΃2IYQwLAwZ)@$N =SӬKn #M ڥyk`*İKEe /ͳdn ۲u`Xy%F .#j)_L/+;J:AI]'#fr4 JJ]MBbIS2E'KF4 TFIkFu10BpݧNPˎyG~gL=Q3h4UE_IY+s!> P@=h{넰,n*uI[4VmgV*/2g2QK\S'TZks #@9Eʕ3i<SהHǂNI1žGdmA 8))k)MyNzC/Ohjr Ql&yxQ:;&%E/\ n{ڠ\®l1L{tJct-,T#$xcIPu'e{ϹLtMsVIx粐JG}uS5Hi㺉.wR<#E ,pNa;H gU:P94~O.ڢ If8MDpT@Q=92;BwYB}y(@={&e!FDGR su< _Q⒋ú{G>À赧|(>ݢO*.RS*5605 a-C(n#NBU Qm'(^T mF2Z$ "iЩ@qqIQ`%=`m<$;h 8I憉Ck:>D4S{$g#vNߡIHD&q<5 hFҕB6YAHDU8סhʅlnVs`ꓛZujZaR eF5£!pP A+6Zm甒 ;V(m~UW1bU[oh{C-!Ge=HU*y+T6?Hv^lXTףxHjţZ=|˟x=l` v :BLEnpg^Whk@1̷0g' 6{b?ZLP4<2-zS;ql> ?w #$$ѲoqUn̪|Hg.h]1\3AF+:WCf5s?VI]0D+~޼ʟWqz}2꛹wo=bNA+=J^ְq,l\Gbuxi ,oڷSQnIVs%1V~%yŖ:N;X|wZ*/KZC Qxxٍ\4q_oWgX d:dNBJ PN –+B˃ ybtY{#T&xDTHOX!DugD6vB; %`JܸVQJtRh.l!z'K4B_iu]5e w\PA=OA4 ꧋WDII$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-nFıxa&w ]\SCi}bU8@ 2)DDQ9IBg@#̤LjS64Q pw0La%/3_<JsƉDnԔ}Jf甽?tΩ(M& <)WKl@LG))Ԧ~DDŽw@h$4"uLҘuLbBpc1H2R bAS<giChtR ^#f:y)|RtBmt $h/$Ȕ$$`2O$);nݧT!QRFw8NN) @pQ]Ê'EI N$̀qROD'Fy$6Q+;=KcDyp) aFvִN+#(6PUIk2ىA {9}~4Ui}JgƱ+l̩$a?Dq{''"x)NMOIL#_ LxS#Dž<tI$''bFQII)MJbg^䁪r<{& ?*t $1BrO&!4rq^JQ4 Il",΃& ƋoJw4OUW|4<{(<`SDŽˈ۳o{$hktr]"Yj NLelQs3䖱S[!@X[$9'7Ow)'J6Kc=>( \9B.#'e$tQ^@RnBZ DprTFI*p:%yL+=Rk77MJH]4Bf1v'@0yħDzU(!w1tyt4{y@LDk$#44Ou(fn0KAy B%lhns(2{6qB@W-e\j2OrX+P*ueZ/d`Od\jKO (3`g8DI% 9:rCsğ\Z6 a[cC};̧zTk{[uZB8)cQX wDsl[q`R tx" ZT->j.oq;jCرbW $T}R} U=?5A#f8YX' l8~ m“GV艠jIFiCÑyG'4T@R\l^1* sFl d;j`qq$es.f}ƾ*ukcBim&[E uo%fԒ 8~r!ÑʯCvP;>m,:s>*I)aB-]nGn[Xg6 J~SRC^KҘ =mM!I u8۽E.%|24)do%/rBg8HRo1鐦^+9J6RS ]NT6jYF3]&m A*R-f%}ŵme'Uc5w)+F@9IyBw;%nCj&#PfDΩ)s\qP Wan윻X)rxNrc0ˑR{DuQ~KYSv$N#^{MzS| .qzvQCA 񫔚f 'TJ~ 8Qտҽ:+CC|C ݘ?x[vϊi4ߊo`[Z]y҄I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ jI)I$EV;r}3%Xzp&ujdvFDU%J#eI -i:L+6bJtE(a+`6;a &'rp%3Bw$sQfJJSIԤ;qm0$&Jq0|Nh^LS8gR۸gL;g:wQ۴芔'oEjvpJf *@p#RNy1|2#^P )TW:L)8MxHNYAIh?rw; }D $kb[U0@cC()ς t3Ns!NѝSI lw8 XVFE;@Pi'RBn}U-ȔQNvqs,bI2kƃckyR,w xn_]%wS̮./ÉJ|G*-dVc6^7lQAiQFp̑2RDx)RL@I)I$IBd䤥$$BxIK$2I-A$)$HNBQ))I$>O eVeǙZh6K#f8^ۀonmdp(2-88pS-2eD㶲$"L%-)g2K@Ɖ$:Nh &IwI '_<'lH)L@$o)}z/p 6'ytV3}svUhcRhk|<;3|W}SkoaT:Jl6;W>5Y.wS$ -lF0AJQ 92Iw&ceGG4 K P8CNh$' I)wCkkg4.0{T u0EDjq߲>(.iK`pԤH ɋ0SDr>(OeGKc܆YHIpftKƀtRS%*ټJF8IKSL]DqIՐd(A.)w%.4 O 79φX+vRCd5QCiBwD Y#fr5RЈQ3:N 52RQR)NtJaڢ3N>(,:{HCyR-䏼==S=l`#JUo/RA3 ^a(Z;|uܤT$nH4Ng4n)SS+q4N"#gp/>  m`CyRl6=^! K iA s  #w ^甩ormw);{$X;ZC|;]>K-Mk)\t89I#e%N5I h:t=M Y3(7Ot'T$ *{F+߼%JoIA%$=F9&@T2rڅa" (W `{fE9|kNu9XrCk檴<wW{T\+RUIڣ+?V*c̷]Ej ;p(1F7c~E#pt(iDh:irSQ4 $„{@emQ,kFYB 3 9@ļKᩚ$k;ݦ5eӨSKf#D1xk<ڤkq=`47C 6 !2i%W6{d!j&f@-Yߴ*IB9TP9Qk H5IJ^j.bcXM#Tv=R '9CUݧ#B +nS7 ;mi~!e du#U )<typ!U|] J!=}WhRHN~JaKy(cG%*j3,om];E7Sӕf$x}NQ}&BfG R+*@$wB mMZ0!{ФLdžfGcOE'HХ]:N85[ 2^\ 쥟HG36 /Eȭ[Te#rNnh{J$@Ɩ@8V]&9S-o, UvL D=ęg v: mӨj Mh6^)Ɗr<j\N}4II2-3 C۵ 0J[UIv$RnR-1A#uN5@CI@"i11Ů :p4D\?Ixk+,܂+Ⱦ?Om2>+VՏY}AyZV8y%-E_CO0<\"%F*Xy ,sGg.4NS)yj)Yv湼q67A<=A$=on> +Ҳ T҂_d~lJ|]c> GPK=8Q:U*!^5^'}i0,%{=c 깚jxx HWۈ . ņSC\_Sr+un fPǼ9 u@-CRϦ䪖 lgHɢ^3o79ɘ\Ρ]+h#ם%˧% ΰZ7Hy !{WtꇒZja30O@ZVxt.O;ڃce"KAAyOfگ.'U_ZzC:$wK#-;RXx!q]G ض˹W;Upxtf*Wt_QU+D.AL{Jj0Uֲ6#{Bq73!,=?Sn,O6LpUn4NЃ̻} S^;+u"6~:& th 2u2U'AAvJRI$.LjÈN%#t)C]{@D(=Pv7"Fn1((*9HX%l9cd4RE辯WcMu :L ~Z@[Hhtc8ڷ{hUZ\78 +]F|ƫsKIi&]R{klWg6wӬL.Ҷ#I"I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$/.+sD.e)>ӧ[ǒ[n4^7&JmScSkbWs#QQ`6L1MC#"@"G*çFu!̈́- ܤ{)N!p%%!"ݧ(̤bdi< p#U'8=O!y TƖ(w!ǍGdOhiQۺvBK|a'AQպa N!JE9)w*N ; JfgDTvdFӤJM%MaH&T!6(!syQntGd; XxJyK`Tv!zäܥfxL,;P-p&{ V2tV-wUgs忚!^` 3}p7} #cvYvgs➚\ᦣ)rqt+^(Q[DQ! }$c h9C>H'tϰ?*UQ B>=]!FÑYA@":S7֨"fU{sZV X=!mU1I yYvN֝W麋oGCo 53P*90K !~H8Iqt0륓_}QC 0QͭWsRIe{ҫk4N=Ī{]ħ{6980%Gtkrͬ%s<\0~P)h&4 h}{NM'< $l{[L:2xOmtDknDr^3klTEr5 %ڴWr!@DikylHI'{J |,p 꽕?~J D)ASݺv…ֶX9D&}"T6DreI4Hq AqokyA- $b-$p!Ohh0dA=H:#X9TslttID":SV9vB/ vȤY J~uS̷Vx5pJN{_Ph@ݯ "RΦ6ףNq[j0ٷD2q)h5 sG %*7\CZ>jT`V1ʓZ +kp;g^XS5)X[uD ڣmr}mp`KhL\=$9$/[=2S$R[ st9iqAE6<QMʘwrdvN!m%T0AWSU Ds Tk&4I#YN`0ƈNc\ 3sIYenkH%MwEgBJvg65lXMҤ9$0[%Mm=kT+V̞ꄖ9ZcPhqIF 4?obhr%'hw{CXGq;H+S~_Q,n +qfpMwIK.8(,)fZPX QS +vӤ"k ՚x g>5jI;PHaïWOhX4 Ts4d_CeMĖ%cRvA XO#?̀GF.K[ٱ}5XĔq.{+ee;{Bg՛e FE6L:ebIZ`֎Ȥ^|VNNˠj Y ϒ΅MrV+H)%׻3[{˷纯YFh;aSsID GdTbfīҩ4!}lI:I1Em 28Qi r lfC;Y>/$VC J)Mt0 '&-M))y nQ $("2RF: QdE2*e!8:<Ի$LGަJBs  W+ *t]'@rX\q:nӹ|zcO1, 㧉\HW JW_yQ$ ]кhUh%7ʝo[!ëPt\sg\VVvN8:zCn^Cǀt;ˢI2ΗFrKF5:|x;1X>( _쵳݅il}>ׇ),<<4[5Z-hpTI$VI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$tUhW[xq yc!t}'4d6!) |*Jkt_FGcXFhhakPs<Aq?=oRhB{Hat&q:F{c& O*_K fdpI;wNIdIRoI itNg(#Jv6S [ob% C !mN AHKLxX؏dZ}yjK4bLiZwQnrH&e;KIrdBiqӲ+ji$Y(!u)uaH)h:=ڄ| Ohm ƉvUZ .ג$,xS H: vBy!"1y?PߴCHPw!>-dhӹMݠ5#DB,3ZG:'@Si0:n;(fDM$wi‹@R'p9A o(d*FjTXg%lFjmZ%&s˾v3c XDK"XKm#ZSڞ)Vִ{֝RCIqotSƠ4I.;O*NsZ C^ݐ!nPrRB\N,BhaMBA5IK* Sh2.a煤7hUÔ4Hs=.fet:Z=k!ʮ q>)ﰴ@IkC\]Ƥ}]ThqЕo Xw;2BUWrF\ .tq@#C{Ea(prP,"aJkx*%}aI b%p6 qהw{< p_IC <XӷuIlheeV{˳pl7`I S`WϰPs L*i cd6mFqXѩuNcS݀OurV)) FԪ8S ?v+/ R=8d BKu m`{o$᡽T1*LFS2c$(JP;U'SƪzjVUfxBH-JcYi: AHCkAq*`pc8F^vIl)#s`S-זIq$:BVcN@ 6ԫ2c ɵ@.6[XddYwg `ZxDEDPuhh/345o\BXk^1۹y@mDn:GkTmxu7lc@`ͭT_}{:5O@G}U6sΨ--VvC~V?S$Ѫ(dBJz#f%` hvRQVVcuׅRī.drCmSnSVV.G_ `= {"hQH"<#jnݹ4rJ;t Y^,k+0|[jP[V,CDl{4S~vScyE94NJwy0'Dzl=ʬz 2Gel 60!>ͧxOS.1=Bg-6T8E+\D '䑺 wOeBcΨf(2'MN32E?Fg9LD ?sv oVX;tr]0C&PIߵWncwp C(&|U&Zy(uTˉVۆ韒UU!О !8+rFЋ5Vpo<}WoHCeh$걬znJE6R,i'Nw-eѼ@YC7"[нh:*9588=WI5t0C%\>;i]M/5v+W]Rne{\wbWbkwdOh 'Xx9ftm18pPI$VI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$g$:Km̐e\cNr}3Ұ4WM]6A8pƻBk76GfFЧFCa ,` 4<#O[9JH:cr0{!"^`*dBw (Ԅi$‹ R$<$m RDp)mL\A2#!p.TAPC@׺;IP:1„I2(N؞Ou=DxRS)8RC̷E`o%'5Ӻ%FtO}Sƽ}_Tp5I f&9S=JlIEʅkY*߼O%BvPwDc@wL7pPZ`QCXci&NL)2D7hBL:DqvL4N-,y&A[PuK2rjOuc d  $t"|*)XI.`p:BP)(1r1;'i<́#4)._ܟ $)k n `Q۸mI G)!bug}Ѫpԩ;< g8hah3$ $%R?gn tʮ&OtE@ӄF8^ &Χz"9N01 '_ԯhhmb{W: A,ʬ=)~8TnUʱ[S@@TO![FTG<lB%3knI!XwΪ9BZj ®Dbg .H*粳2LyGW,aO &vf JA{@};0ZierCGec`pmt { \X*a Foc">hPKd\r` qV8hS(V!aOS6$$TGH8GAiR> , Ilf6^;= ׏&=p.e}b\ <9Z6(N٤Fˉ@"P 8d}{J?CvCwntbn;PxGf6÷7SdqpDuJIp/mmlr{t^d eCUjvhJ]g`us2qN*/ >Z.`TʩkY))0guƄ c[CAZwdAQC_ D=ZԖځ/Ş]KdLd=k^7Nי4ٱȨh=c*LܒuVLۜD'>J٫TRN44H{xCBTI'RuD#璄%&#A"S)(ВW"S4 W1T*70 H,ssqhkKOu~ 0l=rcaȘyAs'nY+[(9pʽ'CF܈W'Sm[㲛P{cf`pk@));RUR6ߧVoZ#= d~O!ʕoaQ RRkw!I8MmrwT Ip vENM.(t*颙[d._1"ыHXla L/"/]@dO^Ljo]:~}:N#k_ *AHksL;yJcT>$ INs*3rč(ʑSl!3uBsJpQ][?$Z2Kl":vRnL~S ' JX쓉DH%BCDtNZR9P~ jtAti')!AyV1A`.I0BVi'E#[8VۆU !;P#E"I' G.~; iGdzkA&cy-L.$5oÀJ1avQlttS -jsN i25G\|71kxD)jvʝ?q. OD@2S _p{;[w0I ü.Jۚw mӄ9FW߱ELp|TARXr#DPO(hv!Siؐce EK*yN/ѧi?#zF"uzlǀ\ ιAR_e/eK\y.e y bu 6A䮗yZ`-\V2{ i|LsuÕa$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'c NasⰑ(V\$"; R"&];zB5dt4Z:ՐҴmgMAW2XbBىSEc`IIӺj`h&ĉ:y!=a @Ps!NݪvwK6eB-1vB=n#*#H(!rl1;?zv4T'0 !(!4DP7Ct]iu$D"Ǝ 1 k`߂K`Ovƚ$[! rdphU8μ"%3kȧ= !DrcF 7N?z.ݱ&unE)kai~HyL[@>(A" n hpAj6\ x(sG*߰mqp* RWLkeF]JJ6@U,!mƴ:qߣA̮a);۹D["W:PItu eQwpsL%]\BXûj<+;kDQچ&"xKF"y*S*)KMaMIK|PM~ yLB6J FH9D*.nQRDC)C⣩N$ǂ $e8X>HI7cx;8( y5ULLBt'Ir1v*Nʌ{%,G܇xŒA:uJcŰaL;(juJUӎ+/\d cQX5΅oWB ?5}UeEɅSfj[胚uvtSR:5d )(qچӄWAm;{%Qd|k4%6!$*Dw?N[!H̀ÈD;H:o)%b ) μ#P>9 .[ -^FqsdGb({-*lhs}$۬:rA N@hyI sx&nL{%O)> |lIYAG08%E><&i\vx' C%UnPH5h ǟ%iT0;)ёQ66#DI)P]#μ' =pST^ IfNuاiO L9A|P#TG[n.Ipِ#I'x{$D64M-j(P$DQqTEgq 7oYASG)>i:y==4Ɔ$ ;B5T:򒮂t{'q'"7 ,$@hc|ʖCvѨ!vIZi'T]ۏQi۸uDgG~ǵ("_RFݧၬutvDѺ(8L\\⧎ Q$Q1#qkvQP݅`)P(^H Bm3F&xTjJ%wǚ{$G(v[=lƈ/h9B IAѺ'TF(l %wN :_R{H<ʑa(% L;E [kjѼ* yG1SM^ss@p.Pni6XeÕ׳^. hV´<g%UYAmk{yķn㪩gC vVߊ{ѵEI^ml8S Q[_&c%ۊ/NE;`$JK[ړ;#^8a`w4׼ezxIiFZ ՛YB.^W'x,/w)syrk+yt©m sLR>+S'&B ̂x[؆ӻw [Y$iQ}%biCFA7ÅTݺJ$@J#hCqE-{ݻNQVRQ a,ldG%gBGu)8jk2U/RiФ"!Um--&k!Xs8J@PZRU~FI[kw&BEH=R{ Lvn $jѴG=mUkln4M Rx 8ULV۰) nINT(n4h7CzyPpw A ogr V>[x-<1!0|$JU5"Y&4I Pj@&q ʛD& e[gE7"w-HB ڈǀ)"g!DF;X\S1ө-`&n(-) $(v4uMFZR$4h n3$"A W1 ,<{rv⒈tJr݌腠1y@Z7NU+>.T诳mT)h*,ǻ_]>[m¥׺7G DHVUեıa|PHԣ5AMvBs9dNƽpuv}/ c2j\d. .9qDƾahv>N# \#YiQpG ΢4MdKUmdi!04LIq{!\}Sh/QRc0Ä1Q% uJFǺbF !H~˻Vx~ʰo;n%0{$BN$kxD0`USKfO Zmmu.VlwI~p1(ZZ5(Pj{ t=ʛ T n$|R'3h$jyA0=Li! Hrn2Z_KIy3F OXjSt%#h{#aeME ̟!k!aG%L(opq}H:vO)l%&uCx`$4M47ڜ新pu*\e Ƃ$Ga0 )alO\ƴ*bcBև͈*m*Y4{-VfBY':/piw> { ;^[]/!m+7 PFsGb72[<}f"VXzǶgt]2EAi]_JI$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$H/L@ckRc wl$ʯn6VR^7잺Xt x#ƚ535טӞڅ=ĉI[퀧8iEpς2d$Kԝe A՛|D`-aS %f{` 1fBH,ϗ(oЍyNeEAu3&Tš̝;DShc*tM: ݦT~5کm I$i%Hėp[87G$IiD C%LhTְ7ZLyDuz9%Un/#l#YةD?] ]{f}+4ײRQdvP6Ƿ^6?uvA&%0;G*\.*6>] )#&$>VDn謻k+Uv: &Uݨ5J[\n}wX. JO#jh-mjIqX:iZPs*u[pH4tIUs&f|ThN )Oޠ.O6O裣gwH%!Q#oRY&ΰc7hӅ+ IvPk&=pwb`< :(oڭf|T-pUԧmqBSL$ǭ +|5E@*[ 3ʃ 9RRޠhRgP9.5!ʛ]6a0Ji! 9)]Uk߱V_`B+{CĔޭns+f*cdOV29$HȣMYȞ-x<;b ;n6 %Κ/_ƨ GNCZtPڴEcB L PDp tU^'|Rxx(˵ w6eqxIl kuP ?a377=njB-JPu ƛ=Qưu'ԇVTOy}͐Y-< Yq/Zx4PqyR,APIwtvBm,)0| ݢ+qJK SBqi> kW,(Cx* IEN{ JeqFZ9GsY|gI%9VZdAU)- :^wmqq8H<,H{|VY|€kG{۶d5J\۔D2mpCNDRV5,u6na˜"8Eur9n1{{i.-3*?zIm6ƾKk:hkZ5R>!67`]GOβ 2ِ{+ Tlf}% lD%0&_ C_t8x.S9ޮ:?Q-sL.kRņSPSҶN\RO*̖zqeJgcobT.yh+!=QU׉%eߏL av!N^L[U$uѩDDX-Ԕ`&Є>) x2ݏ#Qaemp$M!AӢ=aAw .ە!j[JvQXt nT%BƉU+}yCh RRNi;8Eq-t$wLA Q2Plp ,^4 Pc@Tcړ@S;GBW n;q'&l! nTCBơDw(e M΅81³sf0Wf9\nuMx 厄9Z-dK$| k}:)}DQKe;N3?uem[-V6F!&7h;*S8Tx!I΄TՏg h\Xc *w'LAMSeo?haaLJAN熶ZDTXqLӪMLײDF,ǔ{E3赼Fɀ bBI%5.'31*"xMQ{H8;MQd-F$fP-5ЩUQiP=Pfwde̒L(_FmȖV7<H{ uR)@(%%Ph R}pLLT\$Jeuk`%؅FF8[ ˣbOe!JgH%%` M:T\k;@1BMLjr*O%  GNh*(Q{"qSmUuV*APeAHS"O-aYpf8 qi!m:mnhDE#X*$9#s[efwԪk=5vVrIBsByh>=ljQbFy8VӔޫ7X}&j`{ՉT/-{}SכI[r wpc4it^;PvQ:*?yyV{~XF /lRUz}AVI$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$vlꈮ#bu _,r\kÄ <&x\ON6<U*kcl`CxST݀ܶ+3'3T@% 6tN(+庅=XZG u*rG*LmD=>`$aJV2`3O`SA3vICi0JJQni4 DmJd!vi3P@(H$ 0HJGKl& &{)lGrMpeAڦp $5ŮPȶTNR'"$)9vvȒ$;wP<򥵮#PF*ZH<'w #f:JtI!3B I<f;&s@%⓵0R!.EzT "vi̤E-L=%ntvZ:蝎$+lH)9L#*xP6;H v/ !;D*, BO?rJ+Qgw&EϺP@RBSh))Gu+Z[X xRPRGU‹ ʓFKt:IJ<784j8t(Y^t욲|S ܀w꣛IX+ ICY e֤ O M˶3䣊wtY#@@<5r֒>,/Jbtq-iRڐI+!ډRZ6u:F ^HT6{\L#8TQ #t&AvfDh[+T=K'iƒL%IaI kk3k4[=}뎵{OatVBerk͎y2<;Vޘ H?MD`jV,߽ݐzl6DxM.{oԠXVZA %;++5NƸ8Gܭu:) M۪pZ4 )'^ (Eh"םJjZ\_ADe&vFk`ڞҮ\C[.!s~ ʯcAʃ-nյO*KЊS@^#^dBʻ$-6FUco2԰ z= h$k %GV*M;X^ Pnnj!3nѽv=C0`ϊ{#^!K3 uAʛC Z!BYD㺓4k4Jz Bp dm#:Sd)PAi(fRw>C1PkÎ'cǃ(n֔mDpy'~ڂTЬOt-#F-G"y(lKO4+[D).%ʉ=WĢ]D+D (c$\(=m_wGp/pkIDvX"J#c_@jCCtcܠ1N:2-lݨN։E{'5JӝTm 9TEx a)[4%ncZLȨx9NYT ZK xlD enaBBDoFЊ6QKBƩ4):k\~ m4 ]@IYcB;r[ Od2|#l N(m@ͿLlvZ-=E*SX JmRuՆF65R4:;)juB橰oĩ>Pue O &x(\-nm$ xʝ8yly*L9Vc%Ȫi<&sKSRK}{&Nn4BtHH.tUf [!D8-|LV[{;%{-=/Ky듇b]uz] C ~ mp&Yfr1(oO: ;E.Ʒk 5Yk!鑷AUw3;Օn!{Ԕ>Rkkf ֊a2 EۏeI7syIۈ=C;rE ߷R5PtjwBpV( 9, '^mmLJ1hpO7l@t4I5q€(.QAmVq5omTFaIAHQ$6͢~iw@vu:l o |D8C_Ȯ NPpsLPHN~hJ^zDkI6ZBp-65FWYΒt Nj -=jqaimV}g EE۴+xb7%ZCalV,h*>;LwAkE 懖2|3 "[uEsʆKO yI=dhtCk>H!Idw@ptQ{wIwJJvVCmPp߫07}Uzv31k>ו<3GQ. PF qKKI> hS u=dMi:a#22ni N &F.Q AEG(VW) x}]yN4QsI);NJK#@ZS9& !0QD& GtJLuOct|}AwJ+"O*-!L52m#v #@"L{*T6S9N&N絭HM%p;46ut!JR(i:T&!$S G*n#iNRzݱLjn66@Bw3lyۄ9y)5 uT6 pӷ ô9N̲=#)GpԒM-&9Et djЙ%N4QLWE![c̄s"hw?z-yB5"vQkO~TIIL<mx rvQ\Tw5%1q.&jl.<]`D"$yjOoqAtjU.bYa -=7h %7R(U>*. QS)ӷ1~hUk_g[&pQp')UnT*586dX@sohAOR-:K:*tmP ̘XXdr<0|'֜F>5jH?㋪!l5%ILuw \O@_)$,kI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$47xIE$VcXQf_JRI-UFv3Ō#~ʾ'iRoHi *L@px Flrf1W+.=)1oWWV@ >!u;H DwPcO:ws){Qp}#,p#'OE7oM=sʢ܉lJwyCtփʋ!YwA K8i㲝\BdD!l6BH!8?Dp.T\w]@em'A@!*}4Ηh;' !Sei)7kLʋ b:n<[,w~alfnlU?YA%ix&Q7x,2 %h萂)dN&o(@ӟ@vD2t0&vB*yD!@*?MHH F W@Zг詤CޢH0) %Es6y)̈́ \!$lޜJu4AV$5hʸBۜqXg4D{L%Lj%N/VWkE >NğC uT.-AcrmJKv1 ՀiBoµ5Gy@| ʍv$5k~VtTP~)G[-Eh2ᢛ_"JJpMt;qiJhIJGrP;IAxn~{vnW,᪮"vHAϨX#[lw5Vt*˷:FG%JwoeD*&BK镭PL{8(YVll` lRϤf0c4&Fؓf@m#܎r:j[A28E5Wk>H5q}:Zw"5Fmô W066*$9{$ү4np+\C[CÚ=›\zTyJ2Q.n)#u?pR/`|^[IgT4aԞ0SjM@Jp0 jC+,Dc|4I5Ei)& ELM%2m0~*{X9 RٮS۴c]]vsZ95PnMbɔ Fb7pt aHA`{)54+)n=\ HFY$+87+lCFcO  `jin$zV^@y Ko=Э!HT**y18)-p`0F+rʋO#U܆}n[=][C⡕psv߫Q^F~V] f4e0Eֿpz OL`~ V:vܬI&I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$HI$I$JRI$I$I$I()I$I"2*=*-4$x A:+F\W_dM2I ր=^p5<@fHFm ,*/UuO`Suj3 @ZLXi qt!\ϯ5@ ##dR{ xrPJ])`(gk4()G)h%jL.sPu|. R0AJyR,}#S5AK[sE1'E/5WȷO%6k#zSI T$$̑g}UQ|'^$!ᨗۡPhkCG!P)~P+xs6Νѳwgip~Jb'-ans6g=o_$J C~ki 8VPuZH2Si-4!c]sԒD=F#U`ꝤEu;yB&34F9t 4TYod,T|P0vIi2ѽo !UwCwh4#jBwiʗ\vi>_ $1w] *<tqsj;4VZ8MKX+wt0G{e:ܤ BHY\cXi-l+95FH${˴Nbơ cNQr?HVRی#[g< u\u'NtU ee\lqMmsA{tW ] F4+[W!:}03}@w!*ň64$ ](G*?sdrӪ A ac<;IiNmcep`]Cw?;!"[FZIA5PFiҒDHLkAN tRN\-K'IH@,>hH-8< u[Q+z"j ,3u)vhpraXvL xDܨ4R %˝u"ZhZ5Rn4PK!5o' -Ps焓B5);5*FAɬ{D!ɀ`AӺLhhOd$RN DzJVXt Iy=@)%a0ye.tNlG MAđ!=dI iH9LJ /-ו '\<P A`TZ];6=7< 0۪Id8Rp)`)'{Q]T9IE'#kI*UXָ NKkdlA:e65Sݹh4O~RAk"ZvQ,e1"hVݦTʋdh=l<5qx" (@qL6 LcSls[()NL. НDz3 uRwPjhBÈ#+#A& +oxCUV:IE$C%Xwaŭ#Swtu;X#TkGJn%g0$htBxh7粗c@F+Ck$u@$lST=B;y?$JssP&ZRmT@Q{@<ShCp CcI)I6J#IspAS*U p(%diDr[1*McPe8Yx ;v9G |d=ʑx쪼O9Cs7q K8ZU8Ty. 7C$@ H>ń0@b[ઔapisaMFJC7f O(yYK,6t%i <_;Y 'POo9%nXIUigdξt'v;:xh>h%̫E*ҒUkQMO>{gPaam:+2! ֗5Gt&Y#NPmA WrAn9g8hI(@؟pߢj7I5 2՛CG&~):㹼X߂TV,v+a|s_"8IElB:gdY{KOw;pեTT`CptUnbɞ!k JҾ͠@Efk3<7ix \̪XpskDΨ1u-ڮjK \CTEntnE6lndYKUcf2}~h B!m;=.z̃phlnv7ΐ񹰎((ӡCīvMO<#qvLI>*@ NdDU \ FBd'y*)}"aFI8MsBGt"8TLRp)0iӲ-.߹;  / νl :;_wPnu [^ /Vc{tLtUͺ6WnTq-wj50tZX9nXH:^nj D7ʸ V+Q$i* `ۛ{,3?i`ub]JoIշtꞶiom Xkr8%Pwrp襤 UU-̢Z<wkJ'.ݡA^.͌.*0 =<"Z#7! /)I 5{Bi$.ca.2}5w M("-*Dk CS NJisZC {0N_ GB\\hʘ>iTnao$*{M.-r&iod~P0%np8pqTz n½1 Thm7$v*$j'U | 6K7NhkADsE!;ADBY*NppDh#)RC,i  +󊟬 %LDIJLh){IʕBk}A:N q:*eqk$NZeJݎ:hc}ײS5QsL%HhOoٯu+ķfU Np#)!?%kMxU&7hQxR$AAH/QcZP]mp%; d>IvIΑpuLsϊAf~@l}uNjDNGJf77NB¶mi_ixE N X8%ȰpЫaPaTtxNSc{DZϧx#9sF]{a4'0DGmu9xsZ8Δ왖 [+q5%$I.I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$)I$I$*RI$I$I$II2pLb - -|ncT@$Pu +, W4j'hH6 컅7YJNl#GmT٩7 Z:Jy<TwjJDOu n%CYRNֹڧ SN)Sn%I8c{"G(ALZT\v <}B} jil" hS$&'IL-)RnPۯAJ B|HS} )gi#c|l]owKIK|[%6էӝtO[G%;ștIL=HdSz54͟*w=|hHjLqEOMUM4RsqZ{ى{=׆Wd̤]k֘ͅaYw[IK|G-Jf#ks@92H#`'NT_-+H Jx7{}c6h@%ڠJCVq~+jPjtaԎVOct\Vc a*;@q2J{ʶ[PAcTcF6uiؤ"T6d&y!Do@Dm@E4rcw\>EyL[|Ci)n H:4߾;U J[c&%a>|k̅+ɊrZ=/?|=jb4em6Ψ޳C=bU%E*a6i<;l.:#uEs㟚躐J綂O?Vio+$)nf$] B@}Q;~dtHb94F}:m Rs"X -%t] q 톉P.zx܍}{QfA. זYIZa-=AS}7T/`-1vQScku0|VO"4Q{59:h$#XF*,#rvhj $;840 {<;`g8Jb7q^]Tz$+F?֖7cO(y7JƙA,4*%M 4W/!ic0Q4U7r,(Z!S'Dd S~H\&Kg@ւ} Ren5 n#n쯽$Y69#U35YNl]XȮO$.kgGA9g@dU \/ cK37ݧ+;kMjqhh3 dnlpX6};,c(HN-*M.t`5Щ8|Ȅ4 Κ3#Y*Q)k'D;\F7 Gd7GyiIDd ^pFhiMOVAnƸUZQ$";|^AӺB=BcKΊA+1zyJmIEe0eV}. 8 FBL9F 0SF[NX;CB86jQAm@{m1* 9:re`E͘NB׫Qi@P=\%ZW1tGLAopc6B|kA Npxr% q0;s(s<_0$J+np0u Y̅p-J c#B'0d;A ;F@?<.Mq&>8IDkJqMd(Z0aI`W˸1=%n rv2O f%sEYƲ(y J|ͧBH"67@hV8A ִsvIoT8=ml{JϫZeza1E36A}s(7fxJqsЮ骨GB]0r1Lr).K:Qi.%jN=\ڈNTpꭏvx?mqhV6noic8O!iO`$$AAMVŀb=[tWỄUN۲2t2UAS>jAV+ 9F7e=oSza4'Dr*I$3r=WO Ѱgq:t7Cv5'hS{~*6nmn klluL:z!%mU5.#{7!mv -~B|Xά2ǕPdXh&%gYHi CvU``9m/PuӉ--ps"VAmc gIYL- 2d1*7$zΛpNpŇ.N屓` BV~xuK~acuTjlZ'Gs*ײܓ+ &{ hlT|հBw]Jg#T?܆{)a($%lQ5NTR!R_`B~҈5Oh~(dC,DƷoL ,&d Op#cK*rU=-y(1w;VgM{AԁTp?h;=Uz;4N5 hFch%[*VF%6opJýyT!$*A=iE xC`ZӲpN$Bn{ O PƢ GQ0`4$3:IDf>PkU=,v4xqT%Վ? Ϻy?yYmp sKWSo#XFNS@ NQ4ǸF!TdV\ M-8'k|RMeu !:> 4%&rI.3 պ#♷=5 $ :$t)QXSh62BN-{jЊ-i5'7vk`&k8ȩV GtoHVB^SjD%6uIL5DcU:q([plhR:&Rv%PR {<+jl.M1Q pR!c_6J֍dȓBN⥧dΪ w2 ξ V2PaݓXBq F$KܧL?X(l 3pr{!!iv۷8 kS0 xJN'LrJgej{D68hl|7:G5n+EN!$Ȥ2 mc+sDi8 slNCZf;+24pU|  Yv4WCsI զ)aq$I.II$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ )I$I$u)I$I$HRI$tj1_ii`5I ZIE΅Fqhoez}e+͒!@g R'F]NK)7^T9P'DôtLBDV Xqx n j"{MS"\< DdH8i"uI |]l7QsIf ƈ:jΓ- k\R8IMսinHtHY dA<)w> )a$kGTD8N,<8NƧFJ}tLƽEeDޤ )=ӧtpnUF Rn;H{Ls "֓ Uk Q`N O蝧JMkl nߤ^6[4XӨ[Q&|5ϒ n5HT0KZY"R%oMX}]eIHH〓ZARΊNfH6{Hq%}CˮM"><̩h&hqp)oYKO tEU:K;[v9`A<&m4INy$¶HxPVv{?B˲χ7P`>>Eӎ %nSDSF E@Ɛm `$*=RV>*EF>L< Z5Vria00zDn_}NwwʎV}?B:pPd@۠5S/=y>Ge:-;D:ZZZ U7p|rw8-桻DQM!/SwM~v V%:8jӮ?k).<AWuZ>J`}jͣկOj/LBNKyS5"[/ epK a&P{yzIh$Z9u5SnDjOW KvU֫{2}t=K7R27fSU]iW;/ cN`)9SqL8Nph BfWF2H& |(D=w ΉQL&5M;f'.:裸'<RnД@ ,hh ==CkKƉ(1idpNbӧu2@:v QQ$ѴTQv'RsQ.aHj$,$d ݪccE7YjH B;ZvxIib(ejHt =3ᛁ=89JI%3SAi,;Drw]S5̹A3$RITwo M؅YVT$h:9%-YN1ФOp[$9!6{(LI-|y w@F gXL)D8y0$JZ[H:&<fDErMܦq0TuQBy%$)ĄyT)iQfĂ8 )}wAI7R['B9+ƿbAJvtIeSǑ2o@Fc!3ITny0ʃh.q$d NhP.I粅aq>IG{ : A;B1!1NѪ=N2I @^ױPƇn)(`l5EԴ¥]:k_a"v%FA~%2%%Zx&*VZC`pCd+>@a``pU% ~3 T +!ţܦ_(?D8@uA!w=I!pOK7@Vۆ kG*@P+q5죎Mk5iUs;w_aO^@iv56>Ps[I>Ġ°1Cw)GaXUX 4W @gQ,vTtCjpk:|RCccl&;(P0F<եXN(/yk66*钒N̽*uLUPժoI[-2K@BIB{A"=QFpp$[5\ï=밒w&-ϚxxlʄB&4Sٸiʝu%Z`faW=n3(Y-&M'@'- 'ݶ2laPa:J^,;NAVl7;p JbBJkWQaRuRv1v5iŢH;/*CuL%A8ncU!5U~Y涏T>$Kp!K();#&4j>%Sl>_fT 3&&+pGUjނz z%}J+'>4U3'K.j'yIREhb0?R'>["8MYSg=SAQw=%T*OF#K!Rűn4$!T BJX  5v*p.0N3;$E 9QlhkGC9 Nt(9۾H#v l5J}b8௹fNxZl%ЂncHl:,5\X:ZrnhzU%eVM$YK{og=":2CKtv0n&yQ H:pR`!iIRc7k*W7nD]؄WuH]9F8 tFwu &#Mgjf4):t{=\fx @4q]Gr3_$q!sׁ??UMO& D8L59iSYu T& .|[d(!>a$A:HCv*UH$RBnok}&̬%4Sg ?mPK0LItBEڨ9ou)LhEI,tUiiw"}JQ 'U H:&JJl>51Ϊ630HSAL+DSNdUvҎvwDHh `$XdwVkvUas4S^ƲlGL.{{[hZސ)Ȕ@3^!3d& HAS#lpc ^0ѢPkLA n0|t"+7`pxUqat͕}n;f8h͚=뾪^\+Vm .K R I$q$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$H$I'I$BI$IM4$Jo\UBi .RbaDdmVXi @9wd_Ll!LSRo)8QH$ jnx D)Nစ&cHQ:HLH/DKfjdm /Ip@wJ@TwJ}jΩ%aOdst(E2cP_&a%$1w>Ӕa^SB;1$)%0l)44pT D.O) HK64fyRøOD>DRSUO U6>)K߹5=D gw858))swe-d*)cf} @#t>*5okeD-Ӹj5u[ȷ"c`I/(;g 7HbR*mFPs흅v*xֹ"`>iۂm"!$ևZGՒ@:_EZT;`{XqI;xkxUZ78! &Z`ʻN){Ec6\djYxfBcZy%Tq' f@r5B)`T|h~[hcqlD *^? : ^BMaLXI0OmRR )5Pf=w7d1K+2>H5S'S;"ʱّi`Hs"ut68[,0wWT -[kuYvuSqvYxBy K4~$2'EEG\*dQg0@ ٖ+a=Zn(([BV `:c]*-vn婢l)|4Am&s{;bv߅X7zVح{l|K87v8+Gێ#P9,:BrS:PBK}DA"H*ϩ7k6F2-poW[up!rc־g:~ zcn%oWba>5+־o¬Ur^DrJL .rN )kLPU.[J#HN4;H*[dg4)mh-m ☷r} J+\!RI TX ko 4$tb'^RBt8A&?5LƩ%buH\#jfܩ !De9Gq%Cq L~*R JH,( o1*v;t[_#̖Jp4ITƶ퐤l'>rE`a-D{蒀lf+NГFcBw< )CBIYúQ ]X *utuQktӒN-+>~I! nVu &%4{@oL}>wF)\ahc]CS|wSϞۜ1A3++18@8T{2|ݕw4ĔBY׆']Ak%U 5`(9:HNa2k4pD Tl%ֆS dN-CK5 mw(p9P 5Nn|Bhჲ+FЂ1b@܍+`jibA4z]5VY{$.Ƈ6zyźGTP?Oө3A)"Kn(uU:xU=w {RKRA$oVGTk*!Dxy^2-$X [\Otk&B%kBa kDL+ t I욳5lcI ټo] y,$馪UTK[4#Tj;uRu {JrnQsѼ:GH[-jn,L@Rk#o`P\ZPUG3s}ېyXIEN6BDnE yp;17mv@N⊘Qr8G:@jHSkw8N!KNq$ƺt}%YD,]'9@t.A'k@ן5 4U&Ct6?՝.uPcDuTMD tNQ}FdhF5'wT 8DkJ ])"%e2:ؤG)R w"G# dD]uԒnج|сS(r+%ұ(87D>m!ڳNeT{^olKI $$+\@zhqI-z'YVkatP߳ąw8(o;D*Hc`ZTҰY[K Gģc@|P@{$SI=t@q(y QMd<*w5o1j:`xft :Q8솴Lɰi>+@uQ4<2.b zvK_NAwL9<)`OmS8m#Kšg5 fNBnIZJiJ \8q9ic2yYOVqcAda+44lffXSe#-{XKAImOP6!V}&8kȃI1ϊMlxk{y2dȹ ]ջX$?MJv ՑhV)}&u|Q]ѳ[Q.>jUP)ZN{H).e) 8PqzFinUĨVB=~*a0'RRH*'s)?g)uKrJZiQv(k%8$CdT1NG QAŎ%!?(D%RR`sŢyLLTe%/UE'*} R2Q.ˎTwAg—ÄN]=R@|A5PţB]:TDrR86|En]ς>AT II&m y9$6h4*.ӡPkM3d(xBxr*ݏkj yYfǝ);AhZH% 8W4;7!%72iI{{*v;B9U0}oؤJ德0}!Kz}uh ЕUAw݄ÕŤItI$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'L<)$I %%{ 2픤LL(b$h(k;B-U V6hekiDLPցRHӄNS.IL?)I޸sg*ʏsyFfH %7A!WȀ8MPAwN&6: U12Cx?z\O/Y}2}0~> TKPk} O%7RvoWȇm$!\a'HGQ ;#[8tVYHB4Go9X]he\=z`F&W՚;$N maEӨIi -~nƚl?oúBtzGaLGs Ly" NeGiZbΒ[΀!㵎%";Y]8vw: OnQ;i uR$@>p 6QWLHAkD>DfZ`-QPMe =;C,nMy[4#Nqw_.mSǷ_ZXuHAJ7{JB%SdX[-..C8Nw_#*$ LzMO!rZzfNEc+(K2B0i']oD3o6 1CtH>qiVq ?AΕh-bQ﨟E;ȻϪ̷RV;AX΁Dr-BJ*qh^HtQ`3(V!&D&;[ ̈́H)0hc)7j9I]V tiQʉ v o IoVuR񤨰C SgJ75@85%nȝŻ&:-K^#(~"zOJbt RiLI #FP\͎|)K%IW+L;pFsTh1 GtZZ'oܒY&:JtRgb8θ8h8Mp4+:5(mi;N')! $ i$hJ @pu5Ib*tD3'5oHG :Rs$$XP) DkiE@@&4RńxU.xwZ O"kKNyY=2!Rs̤R`+>]&.= ց#R@Ƽc5]LBg%;H{gTZLt[gn`iuP q(> Bd{f@8BJJYܤ*D8p"47 }{\ITSpw-q=.Z_AKaQEuL"+Ұ=;Ip(-?e1G'SNt@ydӬRJ :]cvĠ 쭼{w}!E3"Br8SeN 9NʠRT(OvЂ@UCYD-@#1R}Gt9qPcp8E'F,_%?hRx!ZgWh%ڢ8DEsN!)5 È&/ Y &  =b B&htGcwcHKn/vDx#QX-:D1ηVS2^ZYh FVn$¶X7$γԬsnd[ O8%kIwU3E)-pOKE^蝃4kC\ִp hp2w&źq/v"D#M8Rd5tP{ y{ QJzKDQ`j Kd;U $8:]Eky*x'K ٓ] /(d78 MN֎! ư!T5xZx٪7NP@-z2l,[X qظO\j3ZxPeJMSZoxi%/ XX 5"cY>r$ꚲ { ƞt~Əgc>[\VWa԰nƹ <2ZApip0s#B`(5Ex,$+-;.Uߦi6d-b*]d*}h2TlL  %K,s`\{s~s.aΊ H B%a&@경4NU]{〒(ijvm-a(-;5<)&%#$r 4i)Đ 2p)" OacTdZC[-ڽ\P\;*\۩ TtPxTp1*N$VFB{%OeCZ;"饭/)*.TxQS0Ǒ%&xAv]psuUk`%85ָ+`{RRغxͯGwwWDFc!$x]@mDI$Y$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$:mw~RI&&1 HmSPg 4h( Q0JNrI' <W+TjI8L5)4Ic)8qS߲`Ȅ,JO3ܤIg-q%(FM'}(9ڧ/ySktLU0a;Ѵ&n-k?$}ErwyQSNS F蒗jiKxjiS7T Je"%E$D TR򒙻"4 P>J-SJYSʖ<S"IPuwjKO*@ƈ%%' .[)d&sFܡ\ ѧIIL򓶰ۢ x$DhyQ)6d8)H%4MI-AL\@ vOo.;67.~㻄mon.0:vwDeao2bT@:$ NR$kTktHN)8$ӄN& E7'h#撔RtNnANA?4SFȟuH;NG!BM Cm9; qPӵ9p0dQrꆠ1ҕ 3Fc ?@s˴)5Y$n-%\eBu=ʴ$T?Ufn: Sh}F!W}(caJ-G1%ID亐srcѽ+CN7tp#<"8L0`Q7RԤ5:ZotLJI .u`";Saiս84J?]KwAA{mK;Jc+?DO6SD"T`O榻kLjcLC:Sp ^cpRnt-i( tBfV1 DrQ|qkxA>S1Da"'ȿ*}g0C>+NznhNC߱N❵6| Fwk߲+ k8f9B 2+k=C"E<2Y"{+r7n:C#Po%S>LBV q/5pvsmWgl~#bT~)/v\ψNK|: LB 4%fӸ hU LM5:NfuR/VX5];/syޥ?w30oijq]1b-k嬯1bOXĿ5d|BH E*E弡gy_NDtT,nDhtʝph'✵k $3Rs !ĈQ PI\*\ @'{FIKHO7R :/ Ѩc_qײH1%*\Ȕ'r)=UFƪ2wGd(6AVkx䠒gD#Ö́BeaWi&T2RZwO$Gtn0 ;@X> ˀ;J5LXtt)N3wvC%9q" 0BiS"@T6Gt`۴RAb$:x&-SɃH Ѣy)r2wR)BLnAM4*DBIPh)8JD%D a;; E4J.9'8aIEcmt+\NЄXRHZ<#BXy*M8;+vûD*LV,>rPAQ3cwu5 TysF o hC!gIqU:` DŽKU8w) BvyVhv㼍RIٳXvTp{gh54(FrK, rM-SɪIݹ@P&BG `"$8h5=jcʉuVv…dKW&=O"j-G-UȔ̳S0lA]("RE'SaI,8ʐ$@: hQqK^rlJ h8X$; jJUεDʑvۛ*`;ܪot%i5kew#]b[&tNZ#4D$5@.\ֽ`$ܦ<\HRk|Af#`/;@'Tv`8|(/źjusʙpkv={^5 Jב@'(Np}RH hSʳVFEaǂk'PkNPEuvP(B2 x#E Ape[Lj!D(5phY4n"QcuԦ *\L;P'=&yMM*u2c$l! 60B#D9l$D`\ OtSmzBH;@H]ܨ>ri-J ߸QhDlC Ab1Dh{~-(iZXYΪݹ qT~B(.~e斏dwXn/ܴo2#NK}n:4Sq­m $T[=>Mphr<֞.k^Jk\e]wXcDzwt0ןwE˙?*tX-a0 mLٸDʮl&kvRfF)m60}Of(]:nK iΔ[sA%.N!XiPXX,>i'A$Ìj@R"D͞ .jq *ćAtPAN\U̠YݠKu8}.-j*=pJKiq^ =}:Lu^@%ZB!u;\ܯwF ;(V2=wVX[:d:Y%$IpUg<VUmyLG*GAI!34v $m36cψ[<~iQqjuq@|iu\~򸆷lDQY]p` γ>gNyfC" F!)LЂ q'!q'hPsv̄%4jǰI,O'[ t!B\SD,B[#)%w?o?;;U^'t$ Jb5v{\ۤ6'^>8: m ))~G<RhIO3}o3UùLd'DHEJai:DͬI*-hw*-TTwRyI Ƿ[On-3\{JR Oc ZpTvpNt$x—*%%/]aӴkCp;E8!%"qSswN S\TdLH -*eTQB ӑ=#@ x!h̃!ˁ{(9弧$& ``@E mC 1{y]@%1b9Oi (͹}A`s> ˴ghT7m(;.6`#Kkp_- @ƃqcE`vI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'I(N*y(ZI=8-ʎ.0cDhh1!2hbJdRH $@')pS$'C&AL1Dv uLLS = I wN|R]R"RhRiJc)@LJ'U4LA0SR N1ip) P>)IX))p ƚ&h SMLhEHPcJ7k1dڂ)k(B !A8K~S!)'&D!i&mv~qE#{(rT\ RR \LLL93t瀢_%;H-lIL5!ERs*np !@ )<&%i DO*ta'7IL =u%0e&:ZNH;}MkaCPiFwHӕ!%2sdO GC*:Μ(4P[A5P:N}0rv#$˜?Yڟad~zbLR >߹05kwQs|T DuJ;)I D%-I24&fT +j.'8()^H,1h 5Fx" "6aH6RSaxQ.*42XO 6D@I.:Ѱ%I/DŽ'Z4ԡ8{7HV#H4Fȑ\yAvneM@'@IK$y8|ѥ2@ct':`e//RL3m <U@t?񵺏 CvSG['T7xShdq熴uPvO:W%e3lxVڠFcv%u\$cfi$'^_@1 !kP[SC?DΪv[SZtiZ1w} 9`$rd?SH2wPwYy"ASdm&~ieƚKkCgaDY;V.EݡN洘E!%m5M^]<"h]\ˬc %xG<Ьfmw*n>V;&~ϴ@9Z*V @伲ѨiGu$j[TK'TNZ6|P_?P]Ow4ts(D(;w<*qVXѵcN}Ȇ`A-Cەq ̕J uEphê@TCB@2%VN@X![ j d$B4%NK l|fX7 ۈ.q'D7hPRיּh*! =ی$r=G Im9t\^}wr 4)u)5`wIۅ\FB )9t徯D<46lpx /3^Ƞk% H粳SN<TuktRc RXP2;OgNIG(]c|rB`B;D#T[ 4fp :!FH2O*mc[A>) E+B]# [CL"#ԔD$R0ɏ{|MCsuI:y*ѮjCL %$\th^Ѣ< {2aYFn}Eg> 5U*U+-2TXN[Tq2;*JyA)#v %dpZ]_p@k~)l #r$,vF4r-u@$,0OV-^$*sw &Uo!Ur]h}ey\[I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$IJI$@)4JI$vjmmڐX6脥|cJt)8?)H*@ 6EꜞaqO&8Qo%a HaH8hP!91 cTwG*F \=b@HĞTIR&08R'-$ pSgDHR-8ĩ<%11$4)OnI,\*z2uL$ǔ@f{$w8C.ʓ")Lĝ T\&d)4 tPqTZQB#bH ܉ E3"IHQ;|d&;RN[-qw )0@mTt h"LRsAo*gqdwI;I TK{?R2ʑvjB!0r4IK7De#`h u !' *Mhv%2-E & hI{a 8R #!h)ln#iT[e1)H>&Bq[)O()iL㸨֍JL4ЧiNO(`%.QpgV\L*,R=ra%JKwGlj 8i{Zɂ'PfeMr\:GO`5'ㄭM̌H-Ʃ5tP7ַAaNFCGEL(o~eQcyJ{)*RUeAxy:n '$@<&R^4Ls,a믈HcL- C!Hivh;fڞP"Hﱕitkk!tLR궲>J dj{$N=@S(GbC <ʉg1)ϸH TȀlЌc$RAYi5A-):LNF5#kH ,2W)Rk NB.uyP R }(-nw$˵'T^ITc]$(gUO)p~-ADkCGo"j5*&Zǐ`XZ{$"”!AÿQ䜈:$Gt)R VY X{VAEbە\{ wS%$*XCT 9R2Ȱy5ѠAca[L XJZwEs'RL+h\N Dyvkd5S,tA촬l 7-5l<Gu^u)Nש^B*Csai 7G[; 66R:-Fx Y"RLߕ;}AuS.Uvݯ(h;1+Ng°Ǘjip:'⒆gEn5v(!m ..:"X%%6AH44jSAafpt+SOˡ@:( G+@>arr|;Ɛ kŠI[(Bΐ^ZSWx$Fip!2Ӿf ; xh0u d>)>1#d0WuICPʌ_^> kT.mO-$3w9|RlQ24 J(k,պ@{^dx- hZӕ^Sm꽤%SqQ+G!ۈ- ێdhyV#"6øR{`@I+Vט<򚷒<*62IPFImB Sgă:(A 'jR*]Gn7@)Gĩp>)DQr[*(#MqvB#˹MVUٓ*5 [>F< <*;EKñg 15-l$UcI)!'Xtž-hsW =$Jmu@A{vT{4]6~|"U\Ws+v)&f =hW<Rv9%%m\]S5TW6|^wd /VUj.=VpUJ 8sZ㠅t`I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Iڙ;Q RI$J7P*fà0SɠRbAUPcTƩRxQ2s)M0%$hhS`VI"T'qpV)\Z!j@Ji:$C))ZJfp:Rp!;GtI%.4 38iw)L$ rIKa~Go [Eg^pg]RO5!Bj{<$~EI'!t$BHKyE'TTv5U!h9HLuQ'HxIJЦ&`vQ :mM5Hᤧd;I-N[ALuϑe3LB(dA 'pSP'A L52tILZ L)4QzFP@6YRc%H4ho*6?n;.}9:{8Pނ'-EܢN v)DjDE ۧ@!)Y()+S?Pϰ2@AuA -Z4B|wHi6d@MVAI)h ]9=P ;`r$/y~*{˃CuGh${Q@Of051-,cS'WnɅO6@(3#hi"UU Q$I` ;'#3H*۔v?r k“+kT\~ WY' o]DJYko p c@Z# ~CέܷEE>Pۿ赂\\ =›H qqp1W6.pxoyg3sdMZPt&7VDx`au4VK6;_2F=kD| cC;cCh&(- >"m&tIT`WH䯋Bcmho 4_e#;Y9-#Oi]V6EKf\|:gnoD^oԬby&HUxI'TG>)# r"T >JDUς+\8HTSvQ\IyN NN$Ȣ NpE,= u 3Z@9qp{)V0D$@tHG5q)Et(9z\Aj:)ơ;` PAp{$tN:˛A)qpLY' 4 VͦECgPBI`G(3~C8jp:($NF*@T\#BB%,P9N8$YACͤC$C"N7G8;Fe%/nա9n&4\!E)4Nu$(& %) ';k%7YJxAm3-2!+CkD;48) ;Jf\K8JA \@otsg3A%k2yE]Tݻ%S]DJ: p Z$0ƽf ˫52AԠN<'N4I=fZ-|AK:mi~>hLw .+Ct%CnTW85Byc<ʞCQ2 w3q!p8IA;C5*4<o(0w" E34|ΣD˼P$WG׏{+9kU#%h8Ybi-;h4ۈUrs'" &7|;t-jqŵK]Wun}3-5w ʽFAhLgKScRO`sO?rq#0@9W`IU+d9nAx.,pk`ȓW ̩Z@Wiu0.$;[&ی ǒcTGT#UdX"S{x]RJ".$ǚɷk'[w5 +)=#^U7%h;lh$o j>u\DQHVCϊKE/.0'Q P4 %۱IUPKϹHZ}cJ&+ uTTbYd핢[Uּ<VZ@aFYjPuekӺkK} |7O{t*m"dgT6WEWL@=p% !56<'{@$!Ip1PsK LDXڅQNPS[/x*5k NuU=UQ3]NR[CCZUp5m'P cF}'ѢY 4L%Ӫ."\~?hӓډ ) B!DIv nӯ .vŀ@ ЪseB{,o=+(.a+Is6j ;._YSM>gNa`הYpP [vڔ+) CH(ur%P`הͪ;퀡T4@Rq'J 'RF?)FV۸&D)`Gu <9(JTqDz!w2 πk@Luz;@no4K`۔ݧpQ0>H&Cɺ%lۺ{hg1|B&4ש{=?T|`);N `; 7 [-iu`;N髰UiŽ<|Uu@e6. 5K(nhiOcy :G+sOUE [<>"pQm-2UzPG*]Q3!iS#3gwf Aq=tHA;p1Ps P24MkADQucKJxjQ"ASed6NuL,a:~41 sI3@Kwס= ǂ[uw41õJivy[hR{-~z `{xmVK~E DmMTq۲(qo7B#L:qǚ..(Qt$`!A :ym: 3RYD|q(-N@>^(LA !:XH;]~`r{'/1Ή7"twEs$@Kӎ ^TkyOggDlnoV殾`ARrCNܦ625!-sRÌ>_.)=m?;WSo/`~ L>cX$Fjl;Tx8 /H$8Dx W1u,phT-ҭ0O]D knS(ŢbXK%ǔFtWyXuF;ix[iRJʥn?&|U".)enOiU63@fA4EK=I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JLTUJM"I^ZB5 ډ6,ILj$lrDbKD)m1&J"N pv~)L Q1萂IT1%.9): $];'keDHq$NJg;81Jr: #JT R#@)QxKb7rߔ>iv!̤n'm/Dv 2[q ڨP,%")ΩLh jR[Ht)A<)l"!3|%[#kQ Vؔ骘M5Q}ul۪r$j[j%'D%1eFwh w{H3Q}IRWFF)'mB9bE9.:% J`4Ra"ʻߞ)O0 K-HiG{f'TX$Ȃ T<$^^>@t)nu] !tŮ:vG8yH>I1U/]TG۠ 1G /RS,>i-fm:TrHJyRk#kxGlƩ)?CxwifYY`ٰo fG1Dhis)ck2O :̂EB`Fͮ=tN]J.xA f?LCO1H۰Q9"4/k[%BDA4Le$$pxxp%F}-aμ#P$wL$X,s$F#WccU6Lq Z$5<.양܎Atm`>v F-'RtL`hP~P,;X5Dh}z[U'ot7  iL!Iq@k۫HWt`31Ef U6@ 0Oc+m-p 15yրyLnd*mO%8 sA&At[`FU‹7\&'T}E FY)5ie]9S74TG /Y``Bz]̂\9[缨IkD)eQiRw'o!Uഁ[X51VpwG*t5qa8$hATݍ$Js?89L ~Ud!@ZFM*q@en̞mnf5PJ.o0-Q$=Ck OE:t" S[#by&cRyʮʈBba;p&D$4%& $%=%pIUsrp9Tqk2;D f/ _ DXkntq3 +/o^i&9ײ0yP2Vv-<1/SpH" 0|:7y]mo B@S#O>9I!4$BЙ.l$ѻRqN H+$&q X@L:qCRZr8L@I׸|-7NPI%$RǒeZ$ "59tn-uI ;SO*$E';v2 Rs?;a%/Xe3$BAHkỎ5JJY->jMӓN[\F!٢&^N;$`4mDHl#U&ILKZ3247=o]9))mvRhPanO"A~Dڒ{IDH% vTPg} Dnۄ !C &$#AeLrS4șn uARcXI0J>脔IVk^" ԩlj8B۸N[@)#(x軶T(I -a|x#VvXXh䧥 RS7Xt+{)[+dR'cDHP5N AI]T6hS==dn<'s{frΥ4N Qd*!CKWcfWw@ )$˧UZky;ml)!O)-%cˇG|W%(frKt tU+,BU_)TgMѺW=1kN8[׷C&YZ0= U@A956Z#G8 ^& L-{GJgFsHjN^EH ev-XDI ꏨ6jkP-,+JKeI3\&öq)sFZݴB@Kˆ}+#(6RS c04 &=nL+v\0py*9v+V)Y[(Aę*t!VckYh{,^hSa*}P4C_{Z;bz^y@H]> 0#>x  ƚƟhdt(ۏ٢պ"\ :) j)lc V3,m#M~(U7]y 1M3!"Zd"]4Bjk n*$=Rq,j 9=УԎQWEZȏ$W1YU v*!Xۿ`쒃Cj;*|J-gInTZANnII8hb³Eqa4.y!9:+f@+,vW0KOhT42u,o^ԞKd:HW1~DDƫ7*I6oefth-h$ut\\<_BL9jq2@hi%f f@_ɲ+w5Jcͅ;bՎ{w x9 3QɽMXv9%^Sd\Z5Ae%v81I}Aiνsw"RҢ$m0#^mhuL[^ȅET[ȕ.ۈОuMgR]un]@n!pfJlXDT+J`Y26Ek9"cq h,h8PxD.>!KΤ [ii-o5㪏XSU[HФk?CHj[BJgui 6#y.}N7c tD8jk$\k8 cp';(+14)d8 ZG/h=VuDέ+ShVX:1,G)EZxB@W8~NnuJ̧4m}C2'BD S4R3 n;ku'# TcghѯgX]Z9t ڛn̩i>NeL4jU69:j^,>H#Ʃoe(b;gi@la^xcABAGh1w(9HDJ8(zxW[>JLx)#@:1:"< ZdA)7 1[iC@'uHgv4;I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$v0zv.Ѻ5T1'tGU(МdʜvH$#rM^d ܊D0IR%GQ#:$'TO:$4Ω{!vy)6t蔓-' R Ĩ*Zܒ0> N4H)]w0eE%+R`4R ;ly1 F)b@1NrR:96*DIK@H-(d'tR>iQsuR)R9!ÍRRa?Qt3CyGvR{#I @IK>uIL$i);){FCAuIKk YSkSja)ڢI$,5JQIڜ<3vH$7;S:@uJSS#^`%g?hRѯ*,urVqU.q1“\Iׅ |zJI삘8Ͳ!%pv*]Ƀ7P}ƈ׹Q|nvJlqq E $NoRS^`*νi)-&fnB(FAH)jNaڷ64J.{ Q+tpZvƉ!+ULÌ8F]h&F/-vZ4*@d򂒱eߊ;nh+suā缷k'i)0D;NSpُUT# #fHGCI!U Grh]Dcӣ[[mg>GU,cy;A44r{)W7[Tt$-nUPHH[Ɲy)N##a%l:qߢ85Jq '3 )oDI ŭݺ0LJG 9Q)tHIJ2"ySh3D(h$4;]QZI;'7_rPR'4iV `qoLDҘjH0*D5NKq A (1D! +=:jr*A)TFhT@u:OuaFdKp )䤛bi.o d<'-CCou65˦@os@d E$=P 'XJJbYli3Qr4H%)IHdP~!tCt纑a-;{+!EA>A|QCNKq@$ƨ8A}>hGO>e'2$M*a[ktwRs o-"J>b[k* i++38[{ rK' qmaev4p^r2#<.Kr@o1L&hdVekէ{7BcJr@IbNtN4MxSwIAD%&eD8aH6Pu8‰y&QU-%k Rk=MK+I"-!gL\?AE^a3D)JD#(ovMD= t 6NKH&8˃ j‹&{(Y3  tKt7D͒u쓹9DAv q^\@H0iw%3p(miy3xI'5a;tg:!RkCx?G%I.Ss[ ,=i•J Vƹ۔;I)apI/>ysD!](,cr]X3SфwR5O@% O(ۣ@|S2 .>ZЦ'5w%-H9dB_!(1 0D!Y28@^%'kSPg:"c) m5jjb;Aɼ27G3*,<t$S+4@`]=3a>蓚N?ϊ+%-L;r0G`IOѺ u1¯]'5ݵ$[Kc`u#hv:-V_%Q#V}ǺȔ{ĵ O| $CU0c#YYŴ z)~JfEi(-;sÄ~\:RZЦf&=(]dߌ*tO+b)i ^u~U{NjC}pc7GOuE6ڎ-P*6HyDz:!Uw4I {3±udjy]e=-Z>*O!%LDc=A%lf RTw(X͜j ԡ\ ̵Whnw&U,p {Zcme@ -I*` yLL16Cv8Dy yBs5Rk7[# ?E\Jˌ"55{)7|kYyj5ASWqЬ?kP@fJvψU*SF5@`NpMJٸb$ś,Tj=4Ck*'!$e{+5U0tEsq -vT Sɧ;۸h)5v> nI#E)ۡAVx,;jTڅ}! ʨ#֙KY.v\XƧO=A^5Mxi*7x!U梚U>x*T[j;Ō~)Yǒ.&Ge'ˇs)ƭI=JTk܉s*Eœ{*Ʃ(-x쒝z\:մNȸQ2yRep%WƉI ms ).٦]&S)׹EI] Q$4Rk~HZu>3t' )'l@Ga<5$Oe9PtI肙k: fZÝ[|a nwπb )s$JRhsYxLܰحR5EC`@du`-AW|:]| PHJ@ўbrӼpx7@% )XRz$Zegj`B /E%B> S?y0@IK k9:GdHU쁿Pnƈ\wApxW\5޲9sv9QPG}4M|>Ka㦫y 7q3j9 wZ0Rhs)OSm%?SsHl0{LrM5&R`ڦO)l%._c8HK%y28UD);~ġ!3=M2JA$[i֎ .={|Ϊ4ƭJꍏnꗦD4LA6,@Pufp[vt(`?I֍CƊot敥 <"T1+c%_ s`\O)z`Iah&Ac%\֖`))83 nǗkHtRf#C~aVecf > .Lׅ lmbO4%l;sxR`hwa8i_Wh)ȉA5o|FcScp"A+CM~931/ kt%&{)WCDRhӴQ}vO3QP2wK{4g0 Z\\}E/D$ n/FL)9ne"7jYd`Hc$k ?@5;qn 5PT扈ShL)A(m{gtczktRRfVڌrH'EivE ҕzV1:y!|QS NL4Aqw?E-,l-=4uhVSZAQ[;𫇻Rkȝ~ >z8x$,7adY8U}H!øW~dIk9B:~7Pd3s?ߩ{:VCzSB7 ЩYiG2ZH S[V.SVpmF5pZ 2#Wϱ\꾭౗̘W3kوa%:~i qILJV$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"QW _G-I$ 5"E>db:( px%,1M*LqS4@)\)Qq w%1ktGAS'<|S&Svd^Z"Sn:4L4HF8C 3%I O"3AD9Hd) N*2;yJ~䔼m)$NL&*3LiQt hԨ mLd ROd۩IKQ\| ݡQkSo1vD 9;wʜ܆:$sĞ|vA*RH!F#P[JRB&{TPii>j@J]:@M (k9l1!TRJ's@P7"'Vu5(¢ ((vFFI('%!Q^9nɂRS'[yk~)d4nh4MZ{i<0w@z\ѧCz{ӽ蓈aB5NGLWζZ7sm V~OhYDp D$a ռ  EY*mı x].."Qs0$|cH Jd;|1Y ,:EƄxW74dJN,Ju൲5ɬgvҥXh,bK.'M hmg|U+/6֫tAZ8϶ǀZ [nS4hrƳ{${?ScO N #S&?EKmt \{t "8/L,I o#S!Qj{CkEŰUI貤x[}܂j94 ŕ9%4O)28tUw%pDy&9Am)zDA.f^y0`pӘ)S(H:|U̍]DQdO3 d(X JIJORscp ,_d 4T68#>rrw,~V5h ǰLGEHUqIRoMS1gy:˵>ޣӯ4j 0yPkv:B)I;]%Cz;Q({Z=O++clG2x*I}hˀ|ޞ9/"j  @+q#E-HUj\I+&}*g.WqdUQ=ih4F}oIUȴX8 BN;qTvSeJ(px%Ώ*tT_Xr9V>j`q9Q9ScGsEFaV~ylaCRw#Jii0'#7d1ˎޫl`GphtRLV΂]sJ;;nieC"S7!P h(k+Mh0jNu%HO;)40'@#gL]< )Ps2gJ TdZ͔ҰJ+#8ma~Upn10ՃֲR<vM$ᾛe mlƥvW{l|g25Q}k+Ul .Ѽ*WD[q>zիU..V@i>*^d$Nh0ZT#UcZצKa݂OO$nַhQLv[+W005eXQŚVKb4(om*IIxL]T 3Q;t5 (/"(4GatX Bc +X766N76)(v$2&Z$yk:%K$pAi:n!Hxz\iL&cչvŐfAPoIky$J(x4[hodngT(V{Q`ޥהlhUOKu5%A^S6iSֹ*.N)HvzK+ЭXLHoLm'Y~#^Œ)ӸғW:n. #YLbIf)2) Zd eJB7N]wLeU ϢX[wXv(d%û">zMZi)nkL$!||%Iй;jƇAȷKo 6$Id8P ̑3dF蒘.a7q23MD9DL:h@w:S9JdlUd_cЫ]kǝ#\[YpQiOwy;zo$/;쬚=c!Š°pI CNc,ӹNsKu?`yBj_py!9CB@S M5Dʃ(%uDi?"L& kԐ\'@lGH%ևKTI @})#Y$Gbsg| u NJ^Cw[LĶRSƭyZ)n4R|ИD< i Gw"A *$;Bs )L ΂<Aa}8}yQG!Ai ΃T0 vFvAo;q#_M'Oho"eEǂ;8 x~V^dڤc XF2("0 2Y,2 o-byV:/5UĬXp\^e_ 7Ly!IiX2abk)ϸ#6q)"dV*I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Hz[ /&JoD) J#GT! yN )%*_FkƒJVTD8M=r \xQ )N(QI> )CU2‹Q$DN) Nd5LBs2lpe8$IJ%-<@H=ɝΟTK|ԛ _% BbGt@a8b;Ol0R7T Rfd:x)c^RRS /˜GYSHQF&iJ!x" G/0 t;h9P TNg[EL\~L5n$Hw+ljuEq6p:hpftH46O*Lb i# .Bzq0t bact \T7\b{*'<˹LIS  %iS1k"lv8e\ތ+ Fuw)*}Fhzl<$rI8SnF$. Ha* ;˔g[HUyķʋݮ֩ >j<=K3!Y3X)f8 tU3Kv7@x*-a~`r@:%R[om#h3<*LK%fWw8{=֍%[ T J~ !|܆kpBM76yDsl-2<T-0JϿRz,:"2퍓 O}n֮ xVoddx Eۣk9[x==Wt [|uR.MDǔTWA"cP!HqQ|SIH hx몌yR.M=J..3 ILZ U~jzx$p^qĭJz]ujqu G+AA !Y_u|֐ .W$uis|W*nyl`N#ZM9"&vjZCд_w?[gٖy%sw1 VYu1:IP h#^>:#Zio9:'e5q3lcr\{ʝv9W{R<$U[#D9pW1ltXFdx+B캜ulYִYN Ct,x V;@qZl;yEkxARKYԇ s*nv;hy)Lȭ%j4 <gxh$ʩoSƬxNeDI;%%% #lwOܕ]_O'%iU)cy #0 O?̅sֺJjȅq͖:\YM8:HIQYBEN0cD\v<_L\NpPhyAAX(<Xڔ2}Mp;G [oh*@* 蔆4ݸ%+2J FaĐI$[]gI K@חH#TgVn PZgF0tG0hIU(%$S@[>AUiT0K涒 *X4X}KؒQٻU{KD <6T)ڝQOWO#7#<4ΗkkmѪc{JݶFM≒5Pu4<dxE{새8h AlvD 5{ Pc+uL$ :[t$[IAr!X;V1,==BuZ=(*xCc #Aj2UYpSݎ_{\5@[86cُf!Q{X`wZ6,|F:G,mz_HRc Q}B|yfDxCf| :Z%; {GQ)Pdxv♛\LMWkcX]ؕEH|ɎʴH Z,0]nsX=wEz90 0u-j ]i^^Nt'u[(>\'C5:gh@|Շ:S=Y#5#TYq M7wނ8GkCE[]F:®-؉QXCCe&#{K f] :q-8מRtt$)9'iLA;\D9Hi Xo dnTDʖPz9Up ! O%·v0Ot`*ȻtA\@x$)1$%>(lkk{!Uǒi+In&uA dsy M|pւUDk-2x,% 5jarV,.yWu&c~X]G4\֘{>e>^u=VYHCq؋v3@:uu@/'TظrM}&Dvo1Ϛk04A 8 CyBAQ\: H(LD폂On ݮ u7Vꥦl;\K-¹P<6{`; NW[/tS272 +C yR{7rSDʬ&>)#]Ji.#cډ\6IDJ(E{POa`% q<+&ݎ)A$ s DEeYh hwWv8Iպ7nB]:S wvG*W5pU!cu,à-6RvL,wQǾӹIy 9G~69ƿCs*s( wx&%.]l |8׋ 4ʋYc^Ӭw!8l&-ܝ8Ri888])5_JWoD몒daw*m:=UAmԐ=O`cD2T93 \GSM_nP"x@?Yiռ[-ƭmFOZ !@8 )E;Q/{A'Qg2{:'RRK 7tw@sVve!DB[`1':G 㸀 <׈-XX͡dJJhe${̱Iۜ{aF/J#kZvV{7jNthf WSQ@G'Ʋ^ZxUyh|cAה9t`sf֍Jj{ N*k=c:{B`!K*A(ލuwdVϡ AܦpkuHcgCRS'1! 5y:19ӰBg {5Ox(!/q m3q&5?lQ&}*Al@Ndbs9s6|JkFQ'V%(2o'S۾ :)n: ! o')$݃FAqk#I#xiDݸ&{ :$Q#'8yb[AxRe4r!K5=5%2{Pl-8ry*giQ2ѵ"t;PY^{+E&LB 'JK-sevw@ihhk "ik4Y$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$$JВI-]Ћ(2.CRqE46%N@ %Iue :MTꂔe ԸQ>(4(%2# f9NܞT3Zw8Lo0|TvfVVZWc6  7ڦ{M]Bex'>y7)ڽM%MJ[R:5";4ܳפ"}L7X"%N#CˆS0PK2c6=\ruDwo2x'st T*`S]I YA G=m㲱sGWܥN;`)b[ I?Mۘ|&ny)j SIRS7X 0T\ O* &GNC*P2ck>uyٵmq=d/ݖgCt5cCv@E &IFSf%!f3@`׺6L6R 1%%<*.$-N#@yOtvEJSH$&S $[gg)Z]ÝyZ}e: kIԮwuxkOuWl 4VaMT o}Ga cs1uN|Gyr0\«%Z Yp;+/+[V1:|6|Va$tE7_ĶxE߬xِvOLks652๭*CEE ;OY϶Gu?DĦˏ=GY77J-hK!|S {}%6…D@ gpǝPˤ'!0`jsDZ>F[x`3iPApDlB7;:}fjy@l)tSk7cpJ1eןfL"Ip&Nnݭ@ZX,Z;%JYO*5;n4(:i'qOȾgqe8\\w\(sUf=Ր|PM{qmNv^&o\;¡z-p+Zi#|a tCkQmT,`T<^i}WyOek-%/sy90>Xŷk >*յ\I 4?j,Is=kG  cO\ba; l4c Tdmda1:&6@U8.pVN^y{ѱ$0J#1Sv+McrS)7dVw;x>Y,h:Bk PAI-r![XG] d']fh-*;:K}[h!+:i-0\5CRuVwV()ZL E3jݝ) :vY8{yYV0캗5VfN+aYgC]cH]=ngx=akZ}⬇D%d@p(ȃ &uĵ.X@r#&cX^d-QCuBy9m3}U6X$ v)㢈06ۄ۷Bd7TYMq6k1fx!;L-]AC='HRxw;=8;;Bxս4Qyd);x(ЄԄ!AV}u%'Dc:/S5JICsIq$(>gfS(e($a.T8QGd@uN;-OKh$/qDq)su&A<"7Ӂoq RB! ޤ1$m&){\%=v4wIJ;䩰TPtP6Ge&> 4AFs{$T Y;12P:\8Pk[*t9A5 )結өR{ ;ZI(yJ뢋!e mhHL75DQl'Q#M|5y,m֝i[{M$8BmcI-i++1 !X;Z {gdCYq[6,~Π%uc&ꉬqEsd-N/@<Z֐!x&0@I = Έ L\)w'DD)Uc'[ϴX(naEe4{®;$vSu|gINAAہjE-vvkH$ST,=QC{G+VEWnµ#yp]F5GlpUܺK rwhBƒ xS:&s|HgikvyTH<'eu4R5T<B[u=(aO:y-ec 53`څup@2^< `^+=OTKIjHs`B 9T\M!KAUB*Kd F$jM݃DFMkvPa%Jmz\,f2QȂժHk 5Q;s  *-R9 ݻQsk-\@OKIQú̶U{D:RPltUClUV2 v= ǂAIp 0D-iw5L ŮB%1lS>! YIpHa8:OIΓ QF+Qщ5I9"[ւ<+2 K#D3^UlX!ąxJ ARݫXYkJǚ˦=G†K!Ud=K[9հVNV:f?tnJ*g趿F.РVt!X_\x cޒFŪI;PU,np ;x<+=ofӢNy_ !ӢtYb{1(Ģ@G(ԛr q]AOޥ瀻@ݜ,rw!W ,a:\^Iqvt[w(QLw%s^olL%KH4eH*mcR$ R4 EKG''ԀT Pv1~3-Yu$PG:?+p?ANR Nԥlv0<- DVsG4e]m3RI0IԍmwnWBͥ~?uX)2 )[&Ja7~p\cݽc7F̦T7<(T4M)H];$S .-N,{Ŗ|TQ@H1TbHPqan{⩽.=ӏWqj}B>$wt螫[[&ϡO&9A<+q '(< t&MA$lA 3}͇i@TMl 65IUo%t 3I<rRwL u) |LۦImY\,KU5큻v0!I$y5SW6FKӯg@G)4OacBfwj (u - JMcӽO~pL)l ZKm缩ńD"9^APZN ,]U54d{|PtBsAR±gbZD(VN wqHqp7@Sh $)n-&s {P,qJH5ov7̧{+o$ S u*ɭ6$'WnHx &-6'Q(kYΤ̻p #3|} qCB:QKomdB+90yi)9$ :{}C{s#PK|{d5P.aT6mÎ<JRmkPQ6. 5KqaLk ;t *ʴX5P 3WJb,6 ;aV[v`?,Џ4+ǶZ!й%TnAK)׉{ 'Vl:V>O1`+'=$}WTS[nxVcpNLA%LdpPWzJ=6Xg/Y}BI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$twʓDNI:+HM#I$tN hq X*\ɈM(N"J%)HA( 'Gt pg]m*4}% tIK*G Dh)RCFjJ]FS$yKvI:IKFJLJ@d%(ݒ"FM kLDF%1 o)#DU 6:jD%,tIh'WrBDDJZ( 2N@N^XRS |T߹6ܢFI bJ] æe%܎G B Gc3w:{\> wdS S^\`FqAKyVߨZm"KrvHiSs0h:!ȼ:z19Wuv4qno{dn;[¨JAM||0K_g;{otrk{'.T\ 4:;-l 9N":)T9I kTc&'IQĺ!SOXSڪ1qݱ4A)p..wo9QgSd⭷X9?x I+5XO܆>ctNF|\4. ]3!48.sp&i+O!Xw K`̪]H~ʪ u-n*0@v6Fi;f}^9ZO(>gheZg<$L$NIoisr˯m7C{uQMeS%Gt9QY~Nf &O [LfC^w8UM(RjqirHL`A"B nEzpFjNC: sHwh^z2oYLGR@W)ϧ!WA M̈(bAIg! 5crXY+i˫7?kx?.`-pt+Gg6S['TRTqMnr5H*\[ n]Jk h?i6Jن*3U&YJ-l/eGhZ8]!\XݧuW!RiP8( qwxYD-WʯtyxUJcP=YO <%X'iLײ6n6X|Ѫ8M: AMgTN^ΣCt/!)Sr,,y k}h{u#EZFݠ4;`$=eo>@ ,gt<,y|\E3)v1 Ԯujy蟒.@}ȥWV"SȮ8qr6-d|xCoLecmoߢ+*e2A)z~6乿FE=))~nF!ŧU1cE vDia;]0%A.SZp.!^-S;h:pMmKy(*-ov3splKnkFIýߐ+L1ktGsDsQ(vE4YL+k#Nx*).l!npdk"ͣ>u?w'"_kC=ILFP`;.hi24o1 )ewCwԤm0 O ]ENp*+% f}PHkʽPi2kf᪰+㒇V"\@\Umvhdez@>c]f{Q ˎ<wB}<"],LBRb;'g-suZtlO*M`hP\]ΑI!30!ݐ)oz9.v*RX rҡq$=%W:4ߥ5mU6S g E)XdO`%uY. J}JhӺ%/tA!%jt8"R&GmDԩ0T?Dy%\ "Z$)2>H>)RX8aA5kCi%C7sAlgA 4zm0` 7ECc`DbG#ۈ BL>KKK]fdAAǦ 2w&;%s~`-zpI%3l].4uGtl$vZ45&{);l@UJjuh6n48AUѸ y-!w ,wkKxB'N4ùEFt1R> XV1T " [/1!,p*iF%YmFt?X,-g VZ H)Ď,麢/Gr(-}㲵EQR3Hh^t\n9ǩFXkqux2Acư7>E7u%;Cdxv> ;_UnwjZӏnNba9*;u`oƚ8{t9Q*,{ꕪc1i`$h$k•p9)R& q:a5Ik4 q =wRJ 2_BoMtN(h\j AZ @ ;3WƠ}{\$ 9Т@K`$buCT {FHXCZ]ts@TZ浰6w %+nU/CNE-cm2 G#Mմ &h:satW߶I 9T>_Q"5SW??ccotSk:"X9df  b^v2^@R134R 4'-1|BTvCAǴF (6έLnkx)`Bg{ϸۋ 5yD >p ;wQvI)d!‹q:.p"9߶3R̩ܘAld8Sh V^횘ׄLOƝ/0hDPOw5JXP\̨W N.n2iBsi{'7pR ci*AЦ! ` >)w3R8KEmk(CGTB^ZaGDV]#E t&^m{]x!5=__׬3f3lq+A]&F0Ĵ$V1d2%cO'egG@S= ^#u.ŏB>2`]ogSN*i$II$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+unx> zlwY:Tx$W) J!(E-eMB;tAzR*@wRk|Jz[ 33$҅'yC5HILX.3(LN*5(R DO*41))N攀%1ptp~)'N$ ^THj4RSo>4RuQOxtH*rRRg0P>I@?Ji!(KP5HNp%,t)2IDTtJvQ*d 8DJ{+,l6(3p:D 6452t n&BsH *-ODZګ^# nL*ۜtbDrICpsWkϙZZ'(V * 9*NxʆFhmo y%k~ !xt2Lmt{.DCyHDE @ԂrRwF%"RR$G*SPL;&׀wdoY%))`;'EY$u` M@ߵ5jp|RC>V?<_b H6\{U=E5qXRQXNt6T'@[K@L r*LM1JDcU kqWBF/lx[޳77k%UzݮRw UD=b۳|'?>CFLOՊs&W[YPgِ~%C*z lorm٧ ˠëJ"ƲQs2yP$X)%N+hh n9S AO$"rB 7()›Y*y"3^y 'pR~rW 6gU y)vݪt*MrK9  tV=[^{Ol5čB٢ԣݖ jU@eXw}^mq8F1 +XRظ-,,1ViN:¸ΟKyM%\IM݌dcbf}q(iq<,[%?8骱^#KZR\OgkkKj2z>tWR$c^|Vs:[$?HG ҂_%`(Y5+k.%edC.3[r9uPګ ~Kjunm}w۠n/'dag`;_Tr1MTcinnd8$W-zoi'luwh1:\+lÞHk0;Y$(~ܣu aWn!װobL;T.fL>K !7% anUY4<"\{F='453LF~*ag AS'stUltVvk$,|Īn`ѷN@/{0dW*`s4%LcT1xA§u { P}ƒऱʝu2 pT R;Kcw:':w;U@>Ҭ7XpAm9a<;"9hôrdj~HH=DG 5]mmiAFsK vR;]!ݕio`הRHpYyhVE`=cI wUߠuFV#TSk[ps0BҧWmW= cAtWmlAsK nAeیXO`o 0os*G]~=t);_2HLA'kE6? yI#X2Ju">*e5RRg8"2F pvVT(ӪpRV, 9QiShܢ=B"UCڒ>xDV`-(* jҢrɂh`wIlrc ZHXYvyn؝w(axAbf4|Toqa  \㪾,:# rZyB3!ԝ Jh<#:ƪ˫/Ė=E2CBGq⊪غ*Gƛ<\CXv :c975҂ׄʪ_:)c<Uz~Bǀ |dvOuk4>TO)H@`{ѰINGDzճࣾ[ napD$6Kd:|P`tO(հB]i`xJ9"(WG!>BcoD&<{F7 h| M ךƊWn ۼpq!!we5rl&[;\ַW| t"9{O <tW Q%U% P ;NAN%#|&j'fEAcx=BD~)rXsD'D/45Hӵ%$G;]S<:'qs{ڡG 墳CH)6Sj1αG@'[`oN<7Ax"kC⟴_<*ccoiVzsđ|Thr&_Pr,%{8@p6>d(uK!%\TبA=,ikB ].ӺHzl]"~lUcmg>j _o#3O$pCc$i f&<vX_X:ok5ƞ@G)kt"dhoR]Xes'iq?%dƓ%<+[nK@%5{zݭ3(w #M- .i;L&'AU#òP뵺ۀn<9j#1sDu'&NN$!zVƝ{"u $<Z54Zt4A?5Tš8H qRi2S熡ݻM564[C`=,+{8tzȁwI3;Z6\0ִ <BC+akGLy;)1sLG!'FO=vYy's?Q AԄqV8>*56 iᩦ4Q ] ubF0 K;+aB#!dG 1">i9Ä앩k*a<|Q*tz(ebO!${T"4Ck$G5-hS? 5C-xEsXZuJ!pL%^ Lqh3~g]fk}EvƜkl*Ea KQ^ƻ*Î0'0y3ACtM[{{~I֑?ܪ&6$ B[Z_FSTŏ }kN̵Z5od OlidnwZ"8Jv)|mcYaD P("GUY S DVO ~ԃ76K jFe@4DQAM ,ͮ?>+,`v\=[<rZt:Juod |5hcFRCG=As<9Lʧ و!7)$teݲ:|bT٘Ց?i }*98ar%p'HKʒ3!Tl%ZD~TmƾJ3_!Mخn-pLaWim el| @qߨn{"s`u$Z`BKI$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$v 0hI-{B3vhe a QNL0[a%)2p❂TA4cakxĉ*.0uBÝg0h409Pj\j1DO*\&7ЦkZ#.0Swt :q=6IBCAIaj4H>tIKJs3fKjh'3"ⓛ%8הR9{U$x*Q⒖%I(M> F 0 :$H&H65 MARsDwILה&u*D<$Z6i(HŸ 됬V2ƀ  )g!M%nr(h5 ځ*miz E!UyJ%@&VG0*TS(hc5Qcu --Ch(Οsn}{VˑwTK$U礥iY⪺ўF6f>eAQ!O*56N4R>i Mdj{4xGͲ'Bfk;ӯI (c$EC5p* li< t Ke^{C% iITfʄ46=d?kxDWkK$vW=_S/, ,Uu)/ANoQqȱ+vRi*#D ΩL )ID% \%4E(%- ' N5Q#rS(\&8IwBtTQvQ)~OZ,m<,"dXSC;Ӗ5v>OH{ uQSjAǰVn{TFhԯuRvc+O RrOV`+ ▼:jTx'M:t (P3TN)|[n8q;UҳT}δ˵JDZbGu c7yg,2nWe-Dqv$ DEk4,-N`*.\1Je3%4B0Ri2`<$Nn#`HT˥&8IHsd"8N=EԤdp$F "tʄµV xmy$M(f+?7btݚ5+qX%W'Or >G|JHIod.lic.9g$@pS'AݫC{<#?eZ#ULDKHn>*.fB ~B5t-1r, 4Sy  #;2erOrVX1,$ sFkIP4kΨT5mځOa0M'T@A6mV̵jϝ>NP6~ N Gބ^kD;*uQ8<ˉ!CbIԪ;AhhkQ$1I}7mVGmʉ0L8L>o19udvU\<Ի8BSM #v`RRܩmLlܛr*+*uY(pj鬴 ue]SXl Q g+Cl;{x,`{"W3C+w}c7q%9tFwhAIE>](` nP,vZ3xT^eery#M;a:Ekü% 4*⍡]c{IF6?Q3O/3`yR2{&-fSI#ۻAJge*I$Od{/U۲3 54YzgRr誃NR![ *LRpxNJܙݠG$cAl&ͳ%T/4s*5:;!YXI"R JvC &>s/p9OX}MzBy)oǨiWF߹ ~Et!S*FE$:WfP:%?]4-i G!0A 5HaZJӤ1wϪݺ#0XCk`xT$jVrɂj,&w!.?Dh5A]_>Hϝtjߵ$a Ë67iqv ű9neoǔe֏|(X;"ZÿDWbKs܈eHj2t94ۭ :\8wP"t;,m#۴auILXtD|<0{*Lfj;.r6D-2;A5(; 6X HPtM %)uDyH7w U(\RSm:fvp *hCuB+ E6{w#taH~dX^aKC~0XRI|PO3&t<#ek.7(,xU Ȏ[ni74AQ#EA V@ʹ[#^=zCkZ! kclלǖhװ !;luJzJ\HI[ I 5 }Q˿s0cV`8j1 jmXpS /Elq}.1opV+i5, dB{*J l\@?D#Vov^ |64 maIGϪ< kXKVis|Bf@>JloO܄ }ť Oe'yErn - 8GOQ F KX%JA)7BTd“D7Av'm㮧D48 lp$᪋[3*/x#x,*@(^ci+:#e=[!{P滾z=#Ӱ{3hh쳹ߤ:\:ck+l,]vPĥp^}qRdy'q0O={uĬUiJ %` K&՝ʕXAY_I3rۢR.0^ǵcjc7G1Đl:d(̤JZLy -nc'QUry{:$=ֱĎڥUk]aѿEzL. 81$,M2K*em/ O:(7;Vrl2 R4&Z{('j6` [K[G%V)um{:N$Q$e1{j Eֲ0SmRt>i>)@uCDe@ajxknB]_ð)sʃk#P7NT e7VI2ЙYDN@;{J.}[䚲jDl kT3M#l gY:4=A!J]JH$m{굾V}}/4 -80$82LANxR KrI\ [H{۩9١[r8XSM.6: ThqTNhkݎ/V@{kq!'5T&0ImeI5xIE8;8j-p<]nQ{tGQk{!@v/cILTvƇU0 Uv{,}Z{+..iBsd뢰!-&$J k74CӧT{H0Z{Ƨ?_$LӨXh )&6e6K;pID2h FD6mj;Hu)(C$jRW^!7{I1%; d 3+Z`n:|lI tRlk$ZH®@<%'^+ʾ}\8uI ^˗oi^o?ayNddW}[l|ʚRLJpI%y$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$[rs`$'Qw E0 $#r"Np%!RJ RdRp焝䝄5$68Qpܑ|hТS^ IJ \TvL%*U<>9Drb|~@'EôꝤ4˵)w%2io'D1*HIDJ\9O3DyR0BdAILu 'RtJ)ˉsBiRR[S5&Sk3 G<R<%[u&&SS87Jp4ſvLtB1)[ 9)Y @A[c`"*IFGFcb(GNy:Ԣ2xT2 G:z3RL('R"L^uPaq()%YAF%Bͬq{y=tSNF+P ;[ϊaI[)JJeU;-ݐ >ѢjMx) |$'~aj5m.)AV6?BK&;TOtR,Ē\`cce\y뜓hcTZq0w쁕nLWQi:ٙ O2FjҦK`%$)SJGDPH)10)RS*M(11JG*:h!<;wNP?rmJt. \'7tDI % O;1:%%1$5 (y GUIM|{ЃOw?ЋDs. %GRBUВSGmq:VFcT;63LcWTBkꍭ%WgZƒt*m ~.̋ cVPkR@ ' JަۛjaxBv)!R^g꥘Mt]&9qhr=ډPeH?vƺ(ʜȐI6m;& @v%4DqDvLd'c2byDʩ|< 9pT,rݺ2$ŞF=1izRo aQh'$OkgE'<0K 6tM'-'(e5HSkp *HtI,-0O+9;@"~聐=ݓn$怛pjhu|[S>p7II{[Qh.7ws "pk#kgJO(Ntc;hIP(ju@CV'^Xn;AIxN'hRNS$3'Еd;訹!&L$l0E)k|8iͨ%Zq;#YX-H<6U}\Xqc9A[ΡVfV0`YC !2k iݟrVUeHX;NkDM`CLhZ ʣ~ ](jhamhN&B0l}77ݴRk+Act$ [A < Z);ΞjvV(i3nQq*[n<k͹d%z`Ʋc\;hA\f>BEx-cVi#^60NhcnF@Kn$׹· ;b>R "AxTB@ID$} kZ n鴔[hPMeBFU+qÌ@N U6TQT](>ہRN8k#*Lq".:POӎF>*eB)y-In=DINAcclpYmu̽¦ nQh\[Ţ֍'D1Ok[``7HtB{0xCs2Z%<+Udf򨽮x*hsU-%ZNwaGC qQS4O[:f5RoJ04RA!'Bp$L. *N]sTx Dp6:#u7`6!NKYkfnοRjSAnoR$UՖN0.w.:JywayE(;ka;R}6B.RHBkdcNEG]Smnkm{+/>UvR{$lP/.2yZ5P+C|^v^)4TV,]Ui$+.Uw+ uI#Du9!YcU5 R-|Gtv!1S A' =McR{FTlۨ)1$)6Drh%0 $ NIaS1i*M:j'B5:v/liRI*82vӄ*Jldq47ې(Οz)s/I)hQ*3 wY 0Vhݪ.~Q*~;v c;F$9ѱ:A:!ߤ IFqWkĢu]%c}yDzl`̉}KeUq<F흑`*{tCe Q0rT`J6; DG ADj:"V5wBt#c\NJ$EdT4O):yR<ΣÖXuV)"u?zH酐7/uуBykF ;SS^]H0L%M$^S-e#lVf/ P^ @4MMRK"r-H{Ǹ_VjsCf{?7y#bR:nWm=w̏o1ت mqV1@yPDB@XRc^P{s3OTk]`j XL!KBjdv#D1Tnv[\";(ŃiԤrkI#RM)ۡS;v KNj{T[CL%6LkE1tHIY_jqst5 ,2;Az1Bn-H(PUEGԳP J ĴGe[Q%XOtH5"%$"S ά\q= ]^xWۺ=_h)0BD)( -wWxU&}`k ڝ]*UEKjp!&\1F9f}p}xB}t ?A{$K\tɊ@ }hz7.<ӊYlЧ,:':J L㴹vU$4V8wZ$ ܳ ;a!4H$JnRw 53m6HH7ڂދVe2 ,pۿl))kctENaU֍8 -[<ӂrd(sLeTvR SKX$ $,KG'fR2HSϟOg@ k70 c;ڞ4Ht d2y<,Q+#t[OVԅ"<PzL k$7et b NSȾ4flkJۦ&){:[{EG'{u^X*&o6~ځ6Ln.)m/^)`?%C:꽤'"*}p">H?4F>c<6TfѐF88*F=fh2!Max2ӨQpcЬ} zp j6T}2LƟvXOґJm=Q Y++S;-) T/ômR㙉~ yUYpq=< g]}tY~)SFٸViCy|,G ,66l5T`dhJ$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$[}5jZ$a3kR]Ԡ0NyM^4) 'P:$쒔JiL%0%8NOp4E4I*$mzqT:9tIߩIJvN悐t ΃=& &IJ@>:IQ" )48N$tQq Ap{{)hȁ@ ?=G#YuRl8쒗,O4Ll=ڦ.S-)! 4NSƪu(%-*/0{(aD':ơMj&٩SdJX>*ֺWYnYc%ڨO*l(Bm*VZ8UK"lV4>)0Ke~jsa$u d#Ӽ jyX`k[ICF'0Q,h@ɀxAI\]gѝUڭf=m`[9tC*aiE;ZR .CG"ѐ"TlJǵ4Q0Jo uV@Z^CN?$;x-M V?HY%n,.mn+0~&Z])̗WYai$}b*gh8;.x&KiҊRH J`#T4pRSܛ%*60rRRЙIK 0;+ 0IZX!{`Iy)1<JT7<rs>VK. Sck?װߢifDP 9߽0Y*%l46cKf0:s͙EVO%4ÔᰊR4%:hRIJL<)OQ))R&L*UV։%%(PD{ >sWpHdh ULgSua֐;YduopZ;.$RqiWUSe0Z` ^Gdl%~v4$kj'@mH21J$9E{!=JYગAkΨvcq^B}1$ ?'ٙ= Qj t8VgAZ+NOf2l81ˉ>u[pzkE81% c%g(f@乬v.*B5ٓ^U}h}o;d`;m v=tXL{W׃e_ĴBO*.G<.۪Kn!ם.S'giiPycI)AZJөm1!:L%37zuV6[{Xo@螩.Ob2j0ǂ5lsS2+N֐ %J:Pҗ;?b7H+kki#p]=$H t] 1L<Ɓr0h>͘D@Kx^'8li  ,tz=ڸ!7; aw`fU`Gp`c8ҫO|ɝ>tk+Wv^Vi.]*χV9 LO`u2j==S `Jchiv?KxTTߐ'9hvFG[Tn3 y&S^9Jo~b+fX fNH`;Apz7W*$JtJY|+M 4:+.{%AָLjDT(ȟ4M;RPs%fBk)DΈ6uB`4F2Z^X>b@pU .k )ʲ 6H,!kMZ '3T6*u6Inq*H< x!\_ۂ{rfUH(L. *O%ym>V)IR3Ql). 4I v7%e5lmnO{Z=ZdeiiNYRcYlm6|4hP`B,z[ft):{".i EѨ 6:?9*]O6W$Yuzu &='?-hJ5oe ;8(n!$kxIsN\`^+t;fhA:'cO()#>cY29aߢDlR4 h-JgGxȨ=Ueeޝc:NZJD;w\0Ǹ!\sxg\eW-:+̻RdVAТ[6JW*[-ay0o$Yhi#L樸BT eh ]kbPٜv=7V 8O ł;*mcH!Vմ-ɺSCܴ]S2)QO hT-K %I%(Q٠ܜq91:ӞƝm*]$X꣚A$4rsY#~1J ۫[?rgKO oMyxՇZ=AmANśUhट6.I#DÂwG)- V:pwJZD)kx &I%ڱr@6 v  {u)oW5rN{``[s浛 l͂ nWo!TeRH9> TƤC9q>[3B!-=uUn]m%*kKPȞ&KE,/!9Vp+~7k HN*&kv:2c0cLSuV^DB-:9ѢN٢gqIHrkPBxL`ZrBhsñ\JyCl([ Z<5TKmN> Q._pNBN]G*NTg5&}R"F#yj:h|S:! Y)7y(=R^8vlTZ$4>4Rs&3ErB-D›N'P\{A0AㄘĒ' uL"K 嗁<"P:_^WYP7v誽[xQYnOrVFj Qw9jj\_ G?Y/h/ aZ,V6Ʌ=Q`d9ܔUd?qt=& AS_55%[ffBBKf3s|SdW@tcVѧ!Y25N{{9 B>>NX?dx qg'PO3.er 깍;4'Rn[U0eh{)ʣe԰}w* }D0j0m |_PJ2)!wYgX]V5qUc{DA&d)1݊h6iu(P꛶<F`邯k ,]zNǏ&-"JAB*lU֏xe{f4V1(0mv'(6O#.S8H:IR LĽIƜ'4>w@'~gFCZ=7j;Lʔ DʶVkqK5UT=F b?몽F܌zKZ@p[u ħPoW(u~csbDJ{ÙI=^>7I01A%!HH&.DêlƩjgQ3/9 [[op!8) 4$dtY4V;.%֑DL5_ JI) :]y|l&Os⫹mJGTHIIKix-u.QKm<܄1Y'4:$ juIDXx(6 6L K_ea v> RK^$؂ )%)1@Mmp:~\=fn]moH%)=v_Sl \c]NA%(HNa%0m:|;{KOÿu8{'ׄ뀃S$)!Jo;pclЍHtKK) I1RSIR[ 8ݴ~ ǪֹU[U63}.ÒB)|T:F ndx?%c:w5 ) oD5enʱUOP}{]%JG1ĉi:JJSJv:~@ƍ'T-%APCWTCU0T ObS#u6-hIY84aŲuhךο(7@{)LR1wwuE8VqL!auk:^Gxp{#dt/{h0BnRH@wQHMʺKI{::km!YEWwT?Jqn(T]-wh`+U[i+ȣ1 ;ú Ú:0-sbx*u~KP6\]a%{,ԎܠSsj-4VsJj$qm?Box!Zׄ͏m pXY5 xp閏iӕV+ %]AQ65?Vy|0VI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Cett[ is. H* TO:&RdMpS&ME! %1 NL R:(v]P RIIL$()) $òiE(-tIJqQ)TftۧAFO!a?))xJBGD N;x1FGwdq)܈ABN)h (HcTŻu:yK]ezxĠ$@GR/(Z=^{pV LmN-v|V/\JP1FvU^>P~tfT^ookCqAEN@kn9 3744vI(qV<=2}v/PzL4!oޘQ%^ BIG)JRQ)M*ADkQ $K\(ѡ%)$gWLny!?$Ff8F-460"m>wQ:!Ժ;3EW/>Ǜl<ێ $I ÌkF86}Lx.sK?I'{ ]JR|,Ι"5eyv}oTH un"Çugt{]-X][ j-0 GmFsN]Iq۬+LpT^4&yE:sxEIMSVx'f9=uv(e-dԥ!wSBD9P2˙h@qu)D 4"Ψg- B;<{TA"274i)<9A+/myV+k !;X쥏aUH:!9P5 &.w<͐xrgLN[563OwdG[#kF+Bh2!cUd[ϊgK5FC7PNJoL5C|ħd[F՜irU\9$Y LlKu^61Boc;1_KVI쪼i#~WEuڪ]An%;X:nY#WE;9dpf gjK)o/N KܝTCKij*\1p(*.aI688BbckÅ0S9FQ+uV ÆBeL; A.i:*p;~ZnkShEA х)!Ѫ=?T 3 B!6X!LI&s4L('D[A3*Ƀ$ ?5[.==('{,Dgd|+$ۀ`%*8v9Þh_>H(rk+vN2[`e5AqPml{=$.!UkZS܌N{xUn;{kj$@k:X4O<RiʆʱE[ur-|éD8ˉMtJ9Nq X!{+#qQ,4VK,B{]m'`a2] xSRCVv~* `q4C͡{]3䁁ŖӢõ'1% T#)%x(q t@2MNppNNСa)KEH1sa5xʳF;&}ӂlt"I)Gd9x`7 "$R kdePB△>Cd[@HOh ">F8h-K_E&Ԥ붘D! m[$=5^A5Cc G&I(r%OpK&gGDF:A42NBvA 9$50xEǮaFբH+(6j|PHt7{uM\oJl'C*A7hhYp})5#5Nȭd-Ce]:;e䆉Y3#}o%tDi.E (4=쿲(ne ۲#vC&Z8V2cVLJ1ýΝ{ޯ5W ReoT/5/p㺰c$,V}i QʃI L:X*OH<v kT_{4(UܮtF8Uo.#l^pW. ƳXLFr}GjFtZՁ n=Fech[:J/ExL ^Yfz d@H$+ihDSŶZ}mmBw'UZ8Mbɤ\}ϟUF:x ?QiNB@逄R?)CMe62cfcGc\ZNh,O $pcXPw3 GSV;l"6LI)H)jK xC4ټ.p?Mpe_BԎ#5lÿd屪t;w- h 6[pjbg[ }j6[QXet^o0 O)位-K;##U J{ o *=0Ub;v9y4^]LPvTdd䐺cFTک&rCdTՃ}o/JkkpjvAO2=P 7աATqȁ-Qƭo׎9c4K9jG9);E ~n4pfF<4zĸA7@ӊ'$)=o[4 pԔ%_W>@);.]}SI& p5CUpC/a ?$sT۠ $2JI붰PL'=ӡ44  Rcs@OܳOޥI(9H R\L&1AV'p #g[6#I*)-c,;vǽ"`C ]۲d3-' >:·oyWYH5 &ڜ b"}$6LV5oC*燛koYx}#(8RxЙD%Ƶ`{ n8CnX9Sn[mKH%(4Q(úHh ;̞lnԘI>$q㺔AS:icDPX!o@S2@t0h#BI82$!g)uJLF3b v@sE'esGhh4T<ëۄB4Qi%H; :7Jjj |4C=?t݇dms,lɵRE) gfkVgByyeK\H]`~$On}VmWmc@{q\x'A~Xgvt H6At#~vMq7=ƠFsNIe m'R4Uc-%<߲} kVn9 $SvHv(\YƸ+? d?j45*b3xQ8'Ō1۲ilH]S^61⫶U: Dj] Û#/+v-݉ n._@/dӣl|BSUl-q)$D$LI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t,V"(H0ҞMISW)1)0'Q:j JM&JQ)Bg7s )DhyS5 r'{3w(q){D )q${$@>ѻU) `FcE'ja5 vNyPTӦO5R:$'q'pQŠȭ9U.ӄt' ۏ וxEO(,Y`BJfQtAz#@<+ 8 #_܂QTiqܭt JVd 4UJƾJ;#X3)/곺C k 0O%= lG!yLs$} e&kp.:W1_HԟV}U+^01UXdUc [Kd*}:_[8hWRmP+5!c|@Xp,JȽOt4{{* C 㺥f$*c~T!6_*F\|N$8EM4IT0H(JR@$\tNJHRpHL2]iᣟ5G.wX-5sE]EBǽJ"]YcOdͬM"!`'X7tV^]6  ~hmz.w%%1cVwH}WITկ1HMB7O-%4%( ZtӐ=Gp=jt|;Jenz@Kj,O]3g5}U£ko DjV.{~w[]JSL$P.JuHiJRt$% ]䒔I  M鞿;xkuр݌ï7M鮹ż$`cCGJIJoWUY_lș!<%ϊq$R'B`3 |RO=F)CJs(~oi $!_h%/S`'CXV~72Wg`}`zgכkyk34o%T3UB.f$#,æùip:&Wpn6;C:>iկZ@wyiL-s L> %8?Xz~k_Qsii|ԾS. INW6LΤ?$-CdywBYs26F5| K^p>WmH*N"I p1 yRgTmbm^fG'[{Hӏ?cySCI XVkí1\mUln*Wd:nr8 _Kβ640~96{J¯T P)1%D( MN=D8)zA8Jzl~ꌎ?s͍&S 6Z,lBcA::)eQ6;wXhNWj$iN5DnҬ H sQ{ҫ# )Y_ |Ԉ#RƒV DZG{lV A n{Ԭh=v=JϥQ{"N⡌*6-[5S.kB*<"jw-+5t"Y"{*WB U9^jz_Rl>x-ˀK" SSocϊw8䙏 L$)-9Q0ݯR#ySJ G7NṬ*٬2k²TGvV`#䶟AƲ@N& x }%k{,yUpB}° $E@5lqǝVM-]Ã,Cuj cUCJuTGBY $fIHy@:հѸ B5:p krr!Ғڶhޭz U艕o`F(͸ƨ3#4zyDY-a Wqn/ D{NX`5INl!ŧHb`*!ѧΎP7 P,yo4*U %Dl24h궝T"25?$H(vyR7$7 yVN&kBv(ݪ(G]yRpG%@no(i:'3\ZT(RsCDnJ5h3!%.N۴N<6ӴꝯTl2 I^77ڢA)T6Zt |uSm *LEG4Cv6IV6 "fm x,NkCI-ci"ǔ[JʠIЧez.AZV^u$=6 MFe%Q#9Q6QVٙ 򥏔]̪c<8x:.jN-::< 'T-ڙ5]Q>_&[{Tb#ȡݠTIĵ*/3 CwBmmP;]r]܅VU_gi!֔"ӄgfIjJsٕu${+⏴SI#ج ~V2 c[gy)& (^dx!5R1i[?hmBQe.V^?i LƓ̢`%5CG<ʕDG(k& jj\ 񰻘 zNх =%QĮr2LAE0E]Y|}4 f7oˆw"ﲍ4 1e" IuJn$z950]^ @I$M-=w'65me {eӏpe!ghKRM%y!܈'d%?3}'ǿTߕfGRqIDWFmN{STz\湠2i-FɪOc)Fmbb7̄zayhꡍӜmpۨLDj5 @jB6Ŷg tUּOXT2AvTGW.c0fFL{(:ؕ0|tT<?NβKL`Χ< KtC-%H}a=xJo1ks''zzz.'S?$2CFv\|@҈@45s_7vt.%ԹYL[˟KOeu;ps躎XppGxU0a*;T!:P-=P6Q"oYvduUNHlN̒ kH$RR|ː̝Lt9V^M{v%ˏHI.RS-ō.aO@p"%5|v z'}S& a$)MYUzD%XU.Ò;vT.)٣G?ҝ4GjAQ$(PMi˫`?k:#q2wOaSWYk S"R5Mixׇu8PM}F `kʗ)\d }q;ˋIT'*mtڦ ۠IIT :=?e`ThRI rUvLʛ`ps20\;Jc-AihU-dVy)RERGMs]X%c2ac OOc{; ۩Lp:wH! 4F ^EĀ{x"aՙI Dqno zYk# $ % HѹN$k,]QgdK]"Qze}BkKOcDf8?YNbo^&3kku-HOVSA v?UZyXO cFP옕$%mM v V pw;Lj;/ӟ]|JO0MH/mUQS$Jv%$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IRNRRI%[^:S[2d0z ;)6P ۢj)SGU6:ec'Mww1'`RHSI9IJ`ڦ`A))6; D$ lH))bOdBM)tL_8hN$[S$$9<${JfИ *`N50`J XDJ[AP:)N@jQR0j͵{*9O5S.%ʥxޘ{+͈ bͦJ 2K Χ{͎/32Tۨ0Z!#8ml`jߩ)XVͤn>+c`*eV`IDy 8H% h֠ .$*ƁƲ*OdT kX$O4;hkw-X`Q:WpyZnHw@$;D|GO,%<ϒmS%%. M AD8PqS&t(H @(7E4\Ek9I$.C=E;΀ת=W3WG ߻{eES5Yj[$̮fF R^;፵O4Kss:I'^g;g5>%Oz;G r`n0%i&nΉƩJsS"|VUo"lwdL絀LZ0`?^jhcމv1*?ZQ۲ Xh'j]YCxӪd׹9Xc4(9jի {( #tYgTTa]miƢ8$ZpBIRI J^RK0s ӰK ]2PVoNDFNӝsʺV  T6ҋuaVka)Ge]svIi$$DvQNJ/$N⒗: 1 P;%?7Ս-KykuƫoW45{+J3\[o>m [r_k'D9Q$Ny5H $1iIR a!<MS'1K /4TL]*>IvN#Gc(!O||wS$֒uݰ&HIK|ѿA(TSGtT}Ҟp`$!I$NNU6<JwpZ'肘=2TI9IsƨӔTy:vGQ waՎGB9˕jQ&Jaft W n0Se16QvIKRPyt+ׅ3W#t:)Yhg<:vUqt=RL62) EH{tPHGI*NtI D'8wQdM!?s@Q7꒘L >_@#F Oc*QCRa)L<⁩D30}DB)S9"aVD?ڠؼJk,US4%s#:q\,p?hǠ Tp#NPA V Hdq(9 pvEYt'H{g' mI#$k5M#G(6T;úݮByCyIi XӤOeRZxSòaG˹̘J{5ocH RZ2|Sk~0qkU|B1 tRH)d !twu;IT74Ol1L4 #<ɖǴB丞kl*cEndvU\:" %D{|G>Bc {*kGkU(I?$VDC,:VUn6u3:wuiPEG[2Y^v;r\^֘De[Y# }Y&;66GsӝlqzPFEcDl|,U6G[8}%7 PE;T`7VZD*۱DưS*츱RE3m--h32}~nj=)M'c2Q!jZJen+b/Шߒ7 4(w׳DS+KPjq:|UK]tm* E&C/uc̠ TuzSkupZs`h| v e=$g-v$C7pC )@u&=A݊yڬ Z!Ea6b7*%N䷉@.%&NQ5RK`6<W}%B)r F"hr1 i-*SwQeS491@]=V-N6%4Ekc0Ӫ}h$B ߻E.#Tޛ]R{By4)ܢH  (;P 68Ȕ*5<HJJ@CMahN8;q-?ڎ$$0Ԛcܒ5i1Q\(`D ͤ'!2[x%AiQ5O 4T2srvR^l$MctҚZ<7ͅ7h'rz@sʭ4FvǗy !B/?%t-k cmXL'm:b2|X/\ĴtlnNv4Ql4@VY!?GFK2+p]oڭ aQm|P.~5}n,Vw4 єƸC0d$\ta>%h]P<;eaΒ'✺4Q2F{gU8 }TU'I\EpOT=]uo#NTzvM7KӚ[d4!8IDVnUC-J3ˮoU k-a-1*0% INJtM;Xۜ`#ǧqT)Ĩ8c'LBwOd"6J:}nwHuHeښy1:ZL#ͱdoh<]NȤ7kH9&4*baTu+7wME1,3۲ȳ׵mx]ESv\I3N u`ٍ\5COcTAv\醻H8KtN!3(kދH7#h\LKLr 2IoLRO UͶb}5oe@v>'ԲLMJms` 6S,ǹCOe+-_ G3pƘ?\{l/hSSV/E*>;اs - p&5~;_O 'L|I%5?H9niX:@ԫU '(nHk |jʒdIi`-<46z tׅX-fyhml lE$ڧ{ɉu`NJq/ "H'ET:#JN -ԯYTkl }6'&h>ctۣD:lF:Ng,qBcĴ+YFR.:F)5úg8Kz h<eshfͩXuLk< Hi#`[^"_w]m$nD*u0<~iOHX}SpH+~ta%{Miǂ~tV8 Z\~ v,y!<eeU*lc>fNך$k=7P[$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IL$K#+@J`V< YB7pb I()tA+ʋIE)h}(pT}h%%0$tBF^| 5`jT@&.e"